Labshake search
Citations for New England Biolabs :
9151 - 9200 of 9547 citations for QuantiChrom Phosphate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... Library preparation for sequencing was performed using a NEBNext® Ultra™ II DNA Library Prep Kit for Illumina (E7645, New England Biolabs NEB). Samples were sequenced paired-end ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Cell pellets were suspended in 800 µL of DNA/RNA protecting buffer from the Monarch Total RNA MiniPrep kit (New England Biolabs, Ipswich, MA, USA), transferred into the ZR S6012-50 Bashing beads lysis tubes (Zymo Research ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 80 ng of RNA of each sample was converted into cDNA using the LunaScript RT SuperMix kit (New England Biolabs, Ipswich, MA, USA). qPCR experiments were performed with the Luna Universal qPCR Master Mix (New England Biolabs ...
-
bioRxiv - Plant Biology 2020Quote: ... and cDNA libraries were prepared using NEBNext® Ultra™ RNA Library Prep Kits for Illumina® (New England BioLabs, Ipswich, MA, USA) according to the manufacturers’ protocols ...
-
bioRxiv - Molecular Biology 2019Quote: ... RNA-seq library prep was done with the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs cat. no. E7420) per the manufacturer’s standard protocol.
-
bioRxiv - Evolutionary Biology 2020Quote: ... dual-indexed Illumina genomic libraries were prepared for each DNA sample using an insert size of ~350 bp and the Ultra II Library Prep Kit (New England BioLabs, Ipswich, MA, USA), following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: The RNA-Seq libraries were prepared using the NEBNext® Ultra™ RNA Library Prep Kit for Illumina (New England Biolabs, Ipswick MA), following manufacture’s recommendation ...
-
bioRxiv - Molecular Biology 2020Quote: ... The amplicons were gel purified and 100 ng of the mutated linearized plasmids were re-ligated by using the NEBuilder HiFi DNA Assembly Cloning Kit (NEB, Ipswich, MA, USA), following the manufacturers’ protocol ...
-
bioRxiv - Zoology 2020Quote: ... of the reaction was then checked for successful amplification on a 1% agarose with the 1 kb DNA Ladder from New England Biolabs and afterwards the remaining PCR product was purified using the Monarch® PCR & DNA Cleanup Kit (New England Biolabs; Ipswich, MA). Purified products for S ...
-
bioRxiv - Zoology 2021Quote: ... a total of nine RNA libraries were prepared with 3 μg RNA using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2020Quote: ... of which 5 μl was processed with the NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina® (New England Biolabs) with previously published modifications to the manufacturers protocol 37 ...
-
bioRxiv - Microbiology 2021Quote: ... DNA libraries were prepared in a paired-end layout with NEBNext® Ultra™ II FS DNA Library Prep Kit (New England BioLabs, UK) and sequenced under a 150-bp read length using Illumina HiSeq 4000 systems and HiSeq SBS Kit v4 reagents (Illumina ...
-
bioRxiv - Pathology 2021Quote: RT-qPCR was also performed on RNA extracted from the 4 dpi lung samples with NEB Luna Universal One-Step RT-qPCR Kit with SYBR-Green (NEB, Ipswich, MA, USA) to quantify the cytokines IL-6 and IFN-β ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Genomic libraries were prepared using the NEBNext Ultra DNA Library Prep Kit with NEBNext Multiplex Oligos for Illumina (New England Biolabs, Ipswich, MA, USA) to enable multiplexed sequencing ...
-
bioRxiv - Genomics 2021Quote: ... Fragmented gDNA was ligated to NEBNext Adaptor for Illumina using NEBNext Ultra II DNA library prep kit for Illumina (New England Biolabs, cat. No. E7645). We performed bisulfite conversion twice with ligated libraries (QIAGEN ...
-
bioRxiv - Genetics 2020Quote: ... Sheared genome DNA was used to build the library using NEBNext® Ultra™ DNA Library Prep Kit for Illumina® (E7370/7335, NEB) and Illumina sequenced by Ribobio in Wuhan ...
-
bioRxiv - Genetics 2020Quote: ... 17-25 nt small RNA fractions were isolated by denaturating PAGE and subjected to standard small RNA library preparation using the NEB Next small RNA sequencing Kit (NEB, Frankfurt a.M., Germany). The procedure includes 3′-OH and 5′-monophosphate specific ligation steps and we tried to lower 3′-2′-O-me biases by 18 hours 3′-ligation at 16°C ...
-
bioRxiv - Cell Biology 2021Quote: ... two-step RT-qPCR was performed using LunaScript® RT SuperMix Kit (E3010L) for cDNA synthesis and Luna® Universal qPCR Master Mix (NEB #M3003) for RT-qPCR ...
-
bioRxiv - Genomics 2021Quote: ... the isolated RNA was used for cDNA library construction using the NEBNext Ultra RNA Library Preparation Kit for Illumina (New England Biolabs, Ipswich, MA, USA), with a fragment length of approximately 150 bp ...
-
bioRxiv - Biochemistry 2021Quote: ... and one plasmid was randomly selected from those plasmids and used for expression with a PURE system (PURExpress In Vitro Protein Synthesis Kit, New England BioLabs, Ipswich, MA, USA).
-
Cryo-EM reveals disrupted human p97 allosteric activation by disease mutations and inhibitor bindingbioRxiv - Biochemistry 2021Quote: ... c.1774G>A (D592N) (see Table S1 for full list of primer sequences) using the Q5® Site-directed mutagenesis kit (New England Biolabs, MA, USA). Each mutant sequence was verified for insertion of the correct mutation using sanger sequencing.
-
bioRxiv - Microbiology 2021Quote: ... One microgram of RNA from each pool was used for library preparation with the NEBNext® UltraTMRNA Library Prep Kit for Illumina® (NEB, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries were prepared by the Cornell Transcriptional Regulation and Expression (TREx) Facility using the NEBNext Ultra II Directional RNA kit (New England Biolabs, E7760, Ipswich, MA). Sequencing was performed at the Biotechnology Research Center at Cornell University on the NextSeq500 (Illumina ...
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries were prepared by the Cornell Transcriptional Regulation and Expression (TREx) Facility using the NEBNext Ultra II Directional RNA kit (New England Biolabs, E7760, Ipswich, MA). Sequencing was performed at the Biotechnology Research Center at Cornell University on the NextSeq500 (Illumina ...
-
bioRxiv - Biochemistry 2021Quote: ... The amplified DNA fragment was cloned into BamHI and SalI digested pGST parallel1 vector (Sheffield et al.,1999) with an NEBuilder HiFi DNA Assembly kit (NEB, Ipswich, MA, USA).
-
bioRxiv - Developmental Biology 2021Quote: Total RNA was extracted from four caudal fins per experimental point using a Monarch Total RNA miniprep kit (#T2010S; New England Biolabs, Ipswich, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... samples were diluted in 10 μl of RNase-free water and 5 μl of the sample were used for RNA library construction using NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... Ribosomal RNA was firstly removed and a directional sequencing library was constructed using NEBNext® UltraTM Directional RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... All libraries were prepared using NEBNext Poly(A) mRNA magnetic isolation modules and Ultra II Directional Library Prep kits (New England BioLabs, Inc, MA, USA) according to standard protocol ...
-
bioRxiv - Genomics 2021Quote: RNA-seq libraries were constructed at the ICBR Gene Expression & Genotyping Core Lab using NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina (NEB, USA) following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were prepped for high-throughput sequencing using the NEBNext Ultra RNA Library Prep Kit for Illumina (New England Biolabs, Ipswich, MA, USA) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA strand synthesis and indexing were carried out using the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (New England Biolabs) according to the supplier’s manual ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 S-FL K-to-R and SARS-CoV-2 S-Truncated K-to-R) were generated using the Q5® site-directed mutagenesis kit (New England BioLabs Inc., #E0552S) or the QuickChangeSite-Directed Mutagenesis kit (Stratagene ...
-
bioRxiv - Molecular Biology 2021Quote: ... The digested products were separated by 0.8% agarose gel electrophoresis and purified using the Monarch® DNA Gel Extraction Kit (New England Biolabs, Ipswich, MA, USA). The purified products were ligated using T4 DNA ligase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2021Quote: ... Libraries were prepared from ∼500ng of input or IP DNA using the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB) according to kit instructions ...
-
bioRxiv - Immunology 2021Quote: ... DNA oligomers with Golden Gate overhangs were annealed and subsequently cloned into the non-digested target plasmid using the NEB® Golden Gate Assembly Kit (BsmBI-v2, New England Biolabs cat E1602L). sgRNAs have been cloned into pXPR_502 (addgene 96923 ...
-
bioRxiv - Genomics 2021Quote: ... cDNA libraries were generated with NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (New England Biolabs, Ipswich, Massachusetts) and subsequently sequenced in paired-end mode with 150- bp read length on a NextSeq500 to obtain ∼40 mio reads (Illumina ...
-
bioRxiv - Genetics 2020Quote: ... and RNA sequencing was performed using NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (New England Biolabs, E7760S) according to manufacturer’s recommendations ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was fragmented and TruSeq-Adapters ligated with the NEBNext® Ultra™ II FS DNA Library Prep Kit for Illumina® (NEB) and 3′-end-fragments were finally amplified using primers with Illumina P5 and P7 overhangs ...
-
bioRxiv - Molecular Biology 2022Quote: ... 25 μl of which were transferred to a new tube and subjected to a NEBNext® Ultra™ II DNA Library Prep Kit for Illumina (NEB #E7645), using half of the recommended reagents’ volumes ...
-
bioRxiv - Molecular Biology 2022Quote: ... AGTCCCCAGCACATAGAAGG hWISP1_negative_reverse: GGTTCTGAAGGTGACCGACT ChIP-seq libraries were prepared using the NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB E7645) according to manufacturer instructions with a few modifications ...
-
bioRxiv - Cancer Biology 2022Quote: pcDNA3-TNFR1 expression vector was generated by cloning with the primers indicated below to PCR amplify (using Q5 High-Fidelity PCR kit, New England Biolabs, Euroclone, Milan, Italy) the TNFR1 reference sequence from pBMNZ-neo-Flag-TNFR1 L380A (gift from Martin Kluger ...
-
bioRxiv - Cancer Biology 2022Quote: ... and bar-coded libraries were constructed using the NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina® (NEB, Ipswich MA). Libraries were pooled and sequenced single-end (1×75 ...
-
bioRxiv - Biochemistry 2022Quote: ... reactions to generate catalytic arginine point mutants for AIM18 and AIM46 were performed according to the Q5® Site-Directed Mutagenesis Kit (New England Biolabs, Table S2). SDM reactions were transformed into E ...
-
bioRxiv - Bioengineering 2022Quote: ... RNAs for the in vitro test were transcribed using a HiScribe™ T7 high yield RNA synthesis kit (New England BioLabs, Ipswich, MA) and then column purified ...
-
bioRxiv - Biochemistry 2022Quote: ... The two pairs of PCR products were ligated together by in vitro homologous recombination using a Gibson assembly cloning kit (NEB, Boston, MA, USA), respectively ...
-
bioRxiv - Biophysics 2022Quote: ... full-length human MYO5 was cloned from the same cDNA library as above and inserted into the pHTN-HaloTag expression vector using the NEBuilder HiFi DNA Assembly kit (New England Biolabs, Ipswich, MA, USA). Subsequently ...
-
bioRxiv - Immunology 2022Quote: ... First-strand cDNA synthesis was performed as a 20 μl reaction using the LunaScript® RT SuperMix Kit (NEB, following the manufacturer’s protocol) and cDNA was stored short-term at −20°C before transcriptional assessment.
-
bioRxiv - Evolutionary Biology 2022Quote: ... Two DNA sequencing libraries were prepared from two wAlbB S mosquitoes using the NEBNext® Ultra™ II FS DNA Library Prep Kit for Illumina (New England Biolabs, E7805L) and NEBNext® Multiplex Oligos for Illumina® (New England Biolabs ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Total RNA samples were subjected to library preparation using an NEB Next Ultra RNA Library Prep Kit (New England Biolabs, Ipswich, MA, USA) according to the manufacturer’s protocol (NEB #E7530) ...