Labshake search
Citations for New England Biolabs :
851 - 900 of 10000+ citations for Urea Nitrogen BUN Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... HeLa-CENP-A-SNAP cells were grown in 6 well plates and pulse labeled with tetra-methyl-rhodamine-conjugated SNAP substrate (TMR-Star; New England Biolabs) at 4µM final concentration ...
-
bioRxiv - Cancer Biology 2020Quote: ... were added to each quadrant of the 96-well plate (n = 24 unique adapters) with a ligation mixture of 40 Weiss U T4 ligase (NEB), 1mM ATP (ThermoFisher Scientific) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Ninety-six 12 μl Gibson reactions were performed in 96-well PCR plates using Gibson Assembly Master Mix (NEB E2611L). The Gibson reaction mix was transformed into Mach1 competent cells (4 μl Gibson into 40 μl cells ...
-
bioRxiv - Genomics 2022Quote: ... Oligomers in each well of a 384-well plate were amplified with Q5 hot-start DNA polymerase (New England Biolabs) using primers SAC615 and SAC576 ...
-
bioRxiv - Cancer Biology 2022Quote: ... reactions were performed in 96-well plates using 5ng of cDNA samples using the Luna Universal qPCR Master Mix (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... of each sample was transferred to and digested in a 96-well plate with the restriction enzyme SbfI-HF (NEB). Custom P1 adapters (Hohenlohe et al ...
-
bioRxiv - Bioengineering 2023Quote: ... for the ligation rounds are added to 96 well plates and their 5’ ends phosphorylated with T4 Polynucleotide Kinase (NEB). After 5’ phosphorylation ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli cells and streaked onto Luria-Burtani (LB) plates containing carbenicillin. All-by-all repressor constructs (Fig. 5c) were cloned by digestion with BsiWI-HF (NEB) and BbsI (NEB) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... coli K-12 strain NEB DH-10 Beta (New England Biolabs, MA, USA) unless stated otherwise ...
-
bioRxiv - Cancer Biology 2020Quote: ... The bound fusion protein was eluted with 10 mM maltose (New England Biolabs). The yield of the fusion proteins was evaluated by separation on SDS-PAGE and visualization via Coomassie blue staining.
-
bioRxiv - Developmental Biology 2021Quote: ... 10 μg of nucleic acid was digested with 5 μL RNase H (NEB) at 37°C for 16 hours and 10 μg was mock digested without RNase H ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.4 μl of 10 U/μl T4 DNA ligase (4U final, NEB M0202L), 1X T4 DNA ligase reaction buffer ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 1 μL of 10 mM dNTPs (New England Biolabs, Ipswich, MA, USA) to 10 μL RNA and incubating at 65°C for 5 min on a C1000 Touch Thermal Cycler (Bio-Rad ...
-
bioRxiv - Biophysics 2021Quote: ... following incubation for ∼2 hours of 10 mg/ml BSA (New England Biolabs) diluted in buffer A containing 20 mM Tris ...
-
bioRxiv - Molecular Biology 2021Quote: ... 20 μL of 1× PNK mix (2 μL of 10× PNK buffer (NEB), 2 μL ATP (SCP801 ...
-
bioRxiv - Cell Biology 2022Quote: ... 1/10 T7 RNA polymerase mix (HighScribe T7 High Yield RNA synthesis NEB)) at 37°C ...
-
bioRxiv - Genomics 2019Quote: ... A 10 μL reaction was prepared containing 1x NEBuffer 3.1 (New England Biolabs), 5 units of endonuclease ...
-
bioRxiv - Genomics 2019Quote: ... A 10 μL reaction was prepared containing 1x ThermoPol buffer (New England Biolabs), 0.25 units of polymerase ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μM dNTPs (0.5 μl per reaction) in 1× Klenow reaction buffer (NEB). Next ...
-
bioRxiv - Genomics 2020Quote: ... and the resulting product was transformed into 10-Beta Electrocompetent cells (NEB C3020K). We plated 1% of the library to estimate complexity and grew the rest of the sample and then midi prepped (Zymo D4200 ...
-
bioRxiv - Molecular Biology 2019Quote: ... XPG solution was mixed with 10 ml of amylose resin (New England BioLabs) pre-equilibrated in dialysis buffer ...
-
bioRxiv - Genomics 2019Quote: ... This gDNA was then digested with DpnI (10 U, New England Biolabs #R0176L) in CutSmart buffer in a total volume of 10 µl at 37 °C for 8 h followed by heat inactivation at 80 °C for 20 min ...
-
bioRxiv - Biochemistry 2020Quote: ... RNA was resuspended in 10 μl of nuclease free water (New England Biolabs). 5 μl of RNA solution was suspended in 5 μl of RNA loading buffer (95% (v/v ...
-
bioRxiv - Genomics 2021Quote: ... 1 µL of 10 U/µL polynucleotide T4 kinase and PNK buffer (NEB) in 20 µL ...
-
bioRxiv - Genetics 2020Quote: ... followed by gap repair by adding 2 µl of 10× NEBuffer 2 (NEB), 3 µl of dNTPs (2.5 mM each ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNAsin was replaced with 10 mM ribonucleoside vanadyl complex (New England Biolabs S1402S) was added to the ground tissue ...
-
bioRxiv - Cell Biology 2021Quote: ... and 10 mM ribonucleoside vanadyl complex (RVC; S1402S; New England Biolabs; Ipswich, MA) for 10–20 min in a 37°C water bath ...
-
bioRxiv - Bioengineering 2021Quote: ... 10 ng of purified PCR products were incubated with I-SceI endonuclease (NEB) according to manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2019Quote: ... 100 ng of genomic DNA was digested with 10 units of HhaI (NEB) and 2 units of HaeIII (NEB ...
-
bioRxiv - Genetics 2021Quote: ... 10 μl of Q5 Hot Start High-Fidelity 2x Master Mix (NEB M0494S), 1 μl of 10 μM shRNA_GA_F primer (5’ GAGAACTCTGAATAGATCTGTTCTAGAAAACATCCCATAAAACATCCCATATTCA-3’) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 μL 400 U μl-1 T4 DNA Ligase (NEB, high concentration formula) and 664 μL H2O and incubated for 120 mins at 23°C with 300 rpm slow rotation ...
-
bioRxiv - Microbiology 2022Quote: ... pcDNA3.1.mNG2(1-10) was generated through gibson assembly (NEBuilder, New England Biolabs) of a pcDNA3.1 vector (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10 ng of full-length cDNA was amplified with LongAmp master mix (NEB) and TSO (5’-NNNAAGCAGTGGTATCAACGCAGAG-3’ ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2μl 10 mM dNTPs and 1μl Bst 2 WarmStart DNA polymerase (NEB M0538S) was added and sample incubated 30 min at 65°C before precipitation with 12.5 μl 10 M NH4OAc ...
-
bioRxiv - Biophysics 2021Quote: ... following passivation for ~2 hours of 10 mg/ml BSA (New England Biolabs). After removing non-adhered BSA by washing the flow cell with PBS ...
-
Comprehensive profiling of antibody responses to the human anellome using programmable phage displaybioRxiv - Immunology 2022Quote: ... followed by a 10-minute phosphatase treatment (Quick CIP, NEB Cat No. M0525) to dephosphorylate the ends ...
-
bioRxiv - Biochemistry 2022Quote: Washed RBCS were deglycosylated by incubation with 10% PNGase F (New England Biolabs) at 37°C for 2 hours ...
-
bioRxiv - Genetics 2019Quote: ... and 10 µL 2X Hot Start Taq PCR Master Mix (New England Biolabs). The cycling conditions in the Bio-Rad T100™ Thermal Cycler were ...
-
bioRxiv - Genetics 2019Quote: ... and 10 µL 2X Hot Start Taq PCR Master Mix (New England Biolabs). Samples were loaded into a Biorad T100™ Thermal Cycler for 3 minutes at 95°C ...
-
bioRxiv - Neuroscience 2019Quote: ... sections were treated with DNase I (10 U/mL, New England Biolabs, M0303S) for 1 h at 37°C and rinsed in PBS (3 times ...
-
bioRxiv - Microbiology 2019Quote: ... and 1x T4 DNA ligase buffer with 10 mM ATP (NEB cat. # B0202). Reactions were then heat-killed at 75°C for 20 minutes and 2.5 µl of 1 µM pre-annealed ...
-
bioRxiv - Molecular Biology 2019Quote: ... Heat mediated antigen retrieval pretreatment using 10 mM Sodium Citrate buffer (Vectors Biolabs) were used ...
-
bioRxiv - Molecular Biology 2020Quote: ... phosphorylated with 10 U of phosphatase-free T4 polynucleotide kinase (New England BioLabs) for 30 min at 37°C ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Promoter substitution used the restriction enzymes AatII (10 units; R0117S, New England Biolabs) and NheI-HF (10 units ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.1 mM SAM and 1 μl Vaccinia capping enzyme (10 units/μl, NEB). The reaction was incubated at 37 °C for 1 h and the capped RNA was purified by phenol chloroform extraction and ethanol precipitation at −20 °C overnight ...
-
bioRxiv - Molecular Biology 2021Quote: ... This gDNA was then digested with DpnI (10 U, New England Biolabs #R0176L) in CutSmart buffer in a total volume of 10 μl at 37°C for 8h followed by heat inactivation at 80 °C for 20 min ...
-
bioRxiv - Plant Biology 2021Quote: ... The 10 μg of RNA was treated with DNaseI (New England BioLabs, USA), followed by phenol ...
-
bioRxiv - Microbiology 2021Quote: ... was incubated with 10 U/ul Lambda Protein Phosphatase(New England Biolabs, #P0753) at 30°C for 30 minutes ...
-
bioRxiv - Zoology 2019Quote: ... 10 µL NEB 5X Q5® High GC Enhancer (New England BioLabs, USA), 4 µL NEB Deoxynucleotide Solution Mix (10 mM each nt ...
-
bioRxiv - Biochemistry 2021Quote: ... as described by manufacturer and transformed into heat- competent 10-Beta cells (NEB). Inserts from single colonies were PCR amplified (using primers pGEM_T7_Fo ...