Labshake search
Citations for New England Biolabs :
851 - 900 of 10000+ citations for Human Hypoxia inducible factor 3 alpha HIF3A ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... 1pmol ssDNA substrate 5’ DY782 ATTATTATTATTATTATTATTTCATTTATTTATTTATTTA-3’ (Eurofins, UK) and 0.75U uracil-DNA glycosylase (NEB) were added to 10µg protein lysate at 37°C for 1 hour ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified fragments were dephosphorylated at their 3′ ends with T4 polynucleotide kinase (New England Biolabs) at 37 °C for 1 h and ligated to a 3′ adaptor sequence using T4 RNA ligase 2 (truncated K227Q ...
-
bioRxiv - Molecular Biology 2023Quote: ... The 3×HA-DHFR cassette was amplified from the resulting vector by Q5 polymerase (NEB) using primers containing a 50 nt overlap homologous to the either upstream or downstream regions of the TGRH88_003980_t1 stop codon (primers “flank fwd Tgurpl11m tagging” and “flank rev Tgurpl11m tagging” in table S9 ...
-
bioRxiv - Microbiology 2023Quote: ... Monarch kit (NEB) extracted and 0.1 pmol of each DNA fragment was CPER amplified in a 50 µL reaction containing 200 µM of dNTPs ...
-
bioRxiv - Evolutionary Biology 2021Quote: Both HLS-C and HLS-E protein at 1 mg/mL were incubated with human Furin (EC 3.4.21.75, P09958, obtained from NEB P8077) in digestion buffer (10 mM HEPES (pH 7.5) ...
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... mCapH2 (Gene ID: 52683) genes were PCR amplified from human and mouse genomic DNA with Q5 polymerase (NEB). The lengths of homology arms are featured in electronic supplementary material Table S2 ...
-
bioRxiv - Cell Biology 2023Quote: ... Snap-tagged human β1AR and β2AR constructs were labeled with Snap-cell 647 SiR (New England Biolabs, S9102S) at 1:1000 concentration for 20 min at 37°C in DMEM without phenol red supplemented with 30 mM HEPES ...
-
bioRxiv - Neuroscience 2023Quote: Codon-optimized human TDP-43-His LIC-A constructs were transformed into T7 express (New England Biolabs, #C3029J) E ...
-
bioRxiv - Cell Biology 2024Quote: ... which was amplified from human cDNA library and cloning into pEGFP-N2 using Gibson assembly method (NEB E2611L). A stop codon was inserted before EGFP in pEGFP-N2 vector to clone untagged APMAPFL ...
-
bioRxiv - Cancer Biology 2021Quote: ... or a polyclonal rabbit antibody against cleaved casp-3 (1:100; New England Biolabs, Frankfurt, Germany), followed by a biotinylated goat anti-rabbit secondary antibody (Abcam ...
-
bioRxiv - Genomics 2020Quote: ... 1 μL of 10 mM dATP and 15 units of Klenow 3’ → 5’ exo- (NEB M0212L) was added to blunted ends and incubated at 37°C for 30 minutes ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3 µl were used for amplification with Taq 2X Master Mix (New England Biolabs, Ipswitch, USA) using a 20-cycles PCR protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Products were then ligated to 3’ adaptor (/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/) by T4 RNA ligase 2(NEB) and 5’ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCr-GrArCrGrArUrCrNrNrNrCrGrArNrNrNrUrArCrNrNrN ...
-
bioRxiv - Genomics 2019Quote: ... was ligated to the 3’-ends of the RNA using T4 RNA Ligase 2 (NEB #M0242L) in presence of PEG 8000 (2.5% w/v) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Approximately 1kb 5’ and 3’ Homology arms were assembled using HiFi DNA Assembly (New England Biolabs) upstream and downstream of this cassette with the following primers (5’-3’):
-
bioRxiv - Microbiology 2019Quote: ... 600 ng of total RNA were mixed with 0.83 μL 100 mM tris pH 7.5 and 0.17 μL 3 mg·mL−1 Random Primers (NEB) to a volume of 5.25 μL ...
-
bioRxiv - Physiology 2021Quote: ... RNA 3’ end dephosphorylation reaction consisted of T4 PNK (20 U/10 μL sample, NEB M0201S), SuperaseIn in 1X T4 PNK buffer without ATP for 60 min at 37 °C ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA from A549 cells (3 µg in 30 µl) was treated with RppH (NEB M0356) at 30 °C for 1 hr and purified by spin column ...
-
bioRxiv - Genomics 2020Quote: ... Fragmented RNAs were then dephosphorylated at their 3’ end using PNK (New England Biolabs, Cat: M0201) in MES buffer (100 mM MES-NaOH ...
-
bioRxiv - Biochemistry 2021Quote: ... Table 3) region of clpP1 was amplified by PCR (GC buffer, Phusion polymerase, New England Biolabs) using isolated L ...
-
bioRxiv - Biochemistry 2020Quote: ... Desalted peptides were dissolved at a concentration of 3 µg/µL in 1x CutSmart buffer (NEB, 50 mM potassium acetate ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Vcan exon 2 and exon 3 were amplified using Phusion Taq (NEB, catalog no. F530L) (see SI) ...
-
bioRxiv - Biophysics 2021Quote: Purified plasmids were digested at the 3’ end of the insert sequence with EcoRI-HF (NEB) to linearize the template with a 5’ overhang for in vitro transcription ...
-
bioRxiv - Genomics 2022Quote: ... 3 ug of input DNA was dephosphorylated with Quick CIP (New England Biolabs, cat no M0508). Following enzyme inactivation with alkaline phosphatase ...
-
bioRxiv - Bioengineering 2022Quote: ... NU-1707L) was added to the probes’ 3’ ends with Terminal Transferase (New England Biolabs, M0315L), which adds a single azido-dATP molecule ...
-
bioRxiv - Developmental Biology 2022Quote: ... Ribosome footprints were generated by incubating the lysate with 3 U/µg of micrococcal nuclease (NEB) for 40 min at 25° C ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mM 3’-O-Me-m 7G(5’)ppp(5’)G cap structure analog (NEB S1411S), 0.5 mM GTP ...
-
bioRxiv - Developmental Biology 2020Quote: ... The bcd-3’UTR was PCR amplified using Q5 high-fidelity polymerase (New England Biolabs, M0491S) from genomic DNA using the primers 5’-GAGTCATCA-TCATCAGTTTCGTCAAAAGTAACCTGGATGAGAGGCGTGTTAGAG-3’ and 5’-CTGGGTCG-GCGCGCCCACCCTTGTCTAGGTAGTTAGTCACAATTTACCCGAGTAGAGTAG-3’ ...
-
bioRxiv - Biochemistry 2021Quote: ... rinsed with PBS and incubated in PBS containing 3% molecular biology grade BSA (New England Biolabs) and 0.05% Tween-20 for 1 h at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... Then the piggy-bac vector pPBhCMV1-miR(BsgI)-pA-3 was digested with BsgI (#R05559S, NEB) and the digested vector excised from a DNA agarose gel and the DNA purified ...
-
bioRxiv - Microbiology 2019Quote: ... for each sample 3 μg of DNase-digested RNA was treated with T4 Polynucleotide Kinase (NEB) for 1 h at 37 °C ...
-
bioRxiv - Cell Biology 2019Quote: ... the 3’ ends of RNA fragments were dephosphorylated with T4 polynucleotide kinase (New England BioLabs #M0201S). A preadenylated DNA adaptor sequence was ligated to the 3’-hydroxyl ends of the RNA fragments using T4 RNA Ligase (T4 RNA Ligase 2 ...
-
bioRxiv - Genomics 2021Quote: ... dATP was added to the 3’ ends by adding 9μL of A-tailing mix (5μL NEB buffer 2.1 ...
-
bioRxiv - Genomics 2021Quote: dATP was added to the 3’ ends by adding 9μL of A-tailing mix (5μL NEB buffer 2.1 ...
-
bioRxiv - Genomics 2021Quote: ... followed by an overnight incubation at 16°C with 3 µL T4 DNA ligase (NEB, M0202). Samples were purified with phenol-chloroform and used as 3C templates for Taqman-qPCR ...
-
bioRxiv - Biochemistry 2021Quote: ... Concentrated medium was collected from the filters and 3 μl of PNGase F (New England Biolabs) was added to each sample then incubated at 37 °C for 24 h ...
-
bioRxiv - Biochemistry 2021Quote: ... media was replaced with media containing 3 µM SNAP-Cell block (New England BioLabs cat. # S9106S) and cells maintained at 37 °C ...
-
bioRxiv - Biochemistry 2021Quote: ... Table 3) region of clpP1 was amplified by PCR (GC buffer, Phusion polymerase, New England Biolabs) using isolated L ...
-
bioRxiv - Microbiology 2021Quote: ... 5’ triphosphorylated RNA was capped with 3’-desthiobiotin-TEG-guanosine 5’ triphosphate (DTBGTP) (New England Biolabs) using the vaccinia capping enzyme (VCE ...
-
bioRxiv - Developmental Biology 2020Quote: ... DNA fragments were end-repaired and A-Tailed using Klenow fragment (3’-5-exo-) (NEB, M0212L), the DNA fragments were ligated to illumina adaptors (Illumina ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3′ dA-tailed using NEBNext® Ultra™ II End Repair/dA-Tailing Module (NEB E7546L) and were purified with paramagnetic beads ...
-
bioRxiv - Genetics 2021Quote: ... Singlet and duplet pools were A-tailed using using Klenow HC 3’→5’ exo- (#M0212L; NEB).
-
bioRxiv - Cancer Biology 2020Quote: ... Positive control slides were treated with 3 U/mL DNase-1 (New England Biolabs, Cat. M0303) for 10 minutes at room temperature ...
-
bioRxiv - Plant Biology 2022Quote: ... and a NEBNext Multiplex Oligos for Illumina (Index Primers Set 3) (Code E7710; New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... denatured and phosphorylated with 10 U of 3’-phosphatase-minus T4 polynucleotides kinase (New England Biolabs) at 37 °C for 30 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... and ligated to the 3′ adapter by incubating with T4 RNA ligase 2 truncated mutant (NEB) and 1 µg of pre-adenylated adapter (5′rAppCTGTAGGCACCATCAAT/3ddc ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... A deoxyadenosine triphosphate was added at each 3’end with the Klenow fragment (New England Biolabs), and (3 ...
-
bioRxiv - Biochemistry 2023Quote: ... The tRNA 2’-3’ cyclic phosphate was removed by treatment with T4 PNK (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... A deoxyadenosine triphosphate was added at each 3’end with the Klenow fragment (New England Biolabs). Illumina Truseq adapters (Affymetrix ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3-4 μg of sperm gDNA was dephosphorylated with 10 μl of rSAP (NEB, no. M0371S) and 16 μl of 10× rCutSmart buffer (NEB ...