Labshake search
Citations for New England Biolabs :
851 - 900 of 2496 citations for Ethyl 5 4 methoxyphenyl 5 oxovalerate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... Eluted cDNA was amplified 5-cycles (NEBNext Ultra II Q5 master mix (NEB) with Illumina TruSeq PCR primers RP-1 and RPI-X ...
-
bioRxiv - Molecular Biology 2021Quote: The 5’ RACE PCR product was digested using BamHI (New England Biolabs R0136) and EcoRV (New England Biolabs R3195 ...
-
bioRxiv - Genetics 2020Quote: ... 3 µl of dNTPs (2.5 mM each) and 5 U Klenow exo- (NEB) and incubating for 1 h at 30°C ...
-
bioRxiv - Biochemistry 2021Quote: 100 μl extension reactions were performed with Klenow Fragment (3’→5’ exo-) (NEB) (Figures 2B ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5 μg were digested overnight at 37°C with FspEI (NEB, R0662S), which recognizes CMC sites and creates a double-stranded DNA break on the 3’ side of the modified cytosine at N12/N16 ...
-
bioRxiv - Genomics 2021Quote: ... 5’-ENGRAM 2.0 recorder was digested with Xbal and Ncol (NEB, CutSmart buffer) at 37°C for 1h and purified ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 µL of linker ligation mixture was added (38% PEG-8000, 1x NEB T4 ligase buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Adenylation of R1R was done using 5’ DNA Adenylation kit (New England Biolabs) according to manufacturer’s instructions and cleaned with Oligo Clean & Concentrator (Zymo Research ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNAs were 5′-labeled with 32P-γ-ATP using T4 polynucleotide kinase (NEB) and purified on P-30 spin columns (Bio-Rad) ...
-
bioRxiv - Genomics 2022Quote: ... RNA was phosphorylated on the 5’ end using T4 polynucleotide kinase (NEB, M0201L) then ligated onto a 5’ adapter ...
-
bioRxiv - Genomics 2022Quote: ... then perform A-tailing with Klenow Fragment (3’-> 5’ exo-) (NEB, Cat. M0212S) provided with dATP ...
-
bioRxiv - Microbiology 2022Quote: ... golden-gate compatible template was created by 5’-phosphorylating with T4 PNK (NEB) and annealing of oligonucleotides ...
-
bioRxiv - Bioengineering 2022Quote: Escherichia coli (E. coli) strain NEB 5-α (New England Biolabs, Hertfordshire, UK) was used for generation of genetic constructs ...
-
bioRxiv - Bioengineering 2022Quote: ... the 5’ ends were phosphorylated with T4 Polynucleotide Kinase (New England Biolabs, M0201L). Each gene-specific pool of 51mer oligonucleotides was mixed with a 20mer ligation adapter (ACAGTCACTTCAACACTCAG ...
-
bioRxiv - Cell Biology 2022Quote: ... with 10 mM 10x Adenosine 5’-Triphosphate (1:10, #P0756S, New England Biolabs). The reaction was incubated in a thermocycler for 37 °C for 30 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ligation was directly transformed into NEB-5-alpha electrocompetent cells (NEB C2987H) and plated on LB-agar supplemented with carbenicillin (100 µg/mL) ...
-
bioRxiv - Biochemistry 2022Quote: DNA or RNA was labeled at 5′-termini with T4-Polynucleotide kinase (NEB) using ψ-P32-ATP as indicated in Figure 2 ...
-
bioRxiv - Genomics 2020Quote: ... 8 μL of 5 M NaCL and 1 μL of RNase A (NEB) were added to every 200 μL of eluate and to the WCE samples (diluted to 200 μL with Elution buffer) ...
-
bioRxiv - Microbiology 2021Quote: ... The reaction mixture was then incubated with 5 units of Antarctic Phosphatase (NEB) for 1 h at 22 °C to hydrolyze unreacted GTP ...
-
bioRxiv - Microbiology 2021Quote: ... Bound RNA was degraded with 5 units of RNase H (New England Biolabs) and the cDNA purified by ethanol precipitation overnight at −20 °C (3x volumes of ethanol ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ phosphorylation and 3’ dephosphorylation were performed with T4 PNK (NEB, Cat: M0201S) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µl Reverse External Primer (10 µM) and Nuclease-free water (NEB,USA) up to 100 µl were mixed on ice ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and A-tailed using Klenow 3’-5’exo-enzyme (NEB, Cat. No. M0212). Illumina sequencing library adapters were subsequently ligated to DNA ends ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μM of SNAP-surface549 or SNAP-surface649 (New England Biolabs; Ipswich, MA) was incubated with the beads rotating overnight at 4°C ...
-
bioRxiv - Genetics 2020Quote: ... and purified with Monarch PCR & DNA Cleanup Kit (5 μg) (NEB, Ipswich, USA), checked on an 1 % (w/v ...
-
bioRxiv - Microbiology 2020Quote: ... and 0.15mM of 7-deaza-dGTP (7-deaza-2′-deoxyguanosine 5′-triphosphate, NEB).
-
bioRxiv - Genomics 2020Quote: ... the genome was digested by 5 μl enzyme HaeIII (10 U/μl, NEB) with 81.5 μl H2O ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA 5’ adaptor was ligated using T4 RNA Ligase 1 - high concentration (NEB) and 10 mM ATP ...
-
bioRxiv - Microbiology 2021Quote: ... 5’UTR was obtained using the Template Switching RT Enzyme Mix (NEB #M0466) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: 5’ linker ligation (1x PNK buffer, 40 u T4 RNA ligase I (NEB), 80 u RNaseOUT ...
-
bioRxiv - Genomics 2021Quote: ... In step 5 extra free oligo was removed by Thermolabile Exonuclease I (NEB). After adding 50 ng of carrier DNA (poly (A) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Eluted cDNA was amplified 5-cycles (NEBNext Ultra II Q5 master mix (NEB) with Illumina TruSeq PCR primers RP-1 and RPI-X ...
-
bioRxiv - Microbiology 2022Quote: ... the RNA 5′ ends were phosphorylated with T4 polynucleotide kinase (New England Biolabs). Adapters were ligated to the 5′ and 3′ ends of the RNA and first-strand cDNA synthesis was performed using M-MLV reverse transcriptase ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 µL reaction volume contained 2.5 µL Luna® Universal qPCR mastermix (NEB). RT-qPCR analyses were performed using the Real-time PCR Roche Lightcycler 480 and the expression of PP2AA3 (At1G13320 ...
-
bioRxiv - Molecular Biology 2022Quote: 5’ end phosphorylation (1x PNK buffer, 20 U T4 PNK (NEB, Cat# M0201L), 80 U RNaseOUT ...
-
bioRxiv - Microbiology 2022Quote: ... Isolated DNA (5 μg) was digested overnight with PstI-HF (New England Biolabs) and resolved on a 0.7% 1x TBE agarose gel stained with SYBR Safe (Invitrogen ...
-
bioRxiv - Genetics 2024Quote: ... 50 μl of MNAse digestion buffer (5 gelUnits/μl Micrococcal Nuclease (NEB M0247S), 2X Micrococcal Nuclease buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µl of Luna® Universal qPCR Master Mix (Biolabs, Ipswich, MA, USA) and 2 μl from 1:20 diluted cDNA template.
-
bioRxiv - Neuroscience 2024Quote: ... the construct was diluted 1:5 with empty pUC19 vector (New England Biolabs) and then transfected with 7.5 µL of TransIT-293 and 2.5 µg of DNA ...
-
bioRxiv - Biophysics 2023Quote: ... DNA was purified using Monarch PCR & DNA Cleanup Kit (5 μg) (NEB, T1030S) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... 5 μM each) from IDT were annealed in 1x New England Biolabs (NEB) buffer 2 (20 μl in total) ...
-
bioRxiv - Plant Biology 2023Quote: ... for 5 h in 4ml volume using 100U of T4 DNA ligase (NEB). After reverse crosslinking and Proteinase K treatment (Invitrogen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Reaction was set up using ARCA (NEB, S1411L or Trilink, N-7003-5) and N1-Methylpseudouridine-5’-Triphosphate (Trilink ...
-
bioRxiv - Genomics 2023Quote: ... and A-tailed with Klenow Fragment (3’-to-5’ exo-, New Englands Biolabs) following manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.5 mM CaCl2) combined with DNase I (10 U = 5 μl; NEB, M0303L) at 37°C for 40 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 mM DTT) or 5 units of RNASEH1 enzyme (M0297, New England Biolabs) for 30 mins at 37 °C ...
-
bioRxiv - Developmental Biology 2023Quote: ... Trypsin digestion was stopped by adding 5% BSA (ref. B9000S, New England Biolabs) and the cell suspension was passed through a 40 µm Flowmi cell strainer (ref ...
-
bioRxiv - Cell Biology 2023Quote: ... EcoRI and XbaI 5’ overhangs were filled in with dGTP (New England Biolabs), dCTP (New England Biolabs) ...
-
bioRxiv - Systems Biology 2023Quote: ... and 72°C for 5 min) (Phusion High-Fidelity DNA Polymerase, NEB, M0530S) using the P7 and a T7-fused P5 primer (5′ TAA TAC GAC TCA CTA TAG GGA ATG ATA CGG CGA CCA CCG A 3′ ...
-
bioRxiv - Biochemistry 2023Quote: ... NEB Stable (lentiviral vectors) and NEB 5-alpha (other plasmids) (New England Biolabs) were used as cloning strains ...