Labshake search
Citations for New England Biolabs :
851 - 900 of 10000+ citations for Cortisone Chemiluminescent ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... DNA fragment overhangs are filled with Klenow Fragment (3’-5’ exo-) (NEB) to leave an A-overhang ...
-
bioRxiv - Microbiology 2021Quote: ... T5 exonuclease diluted 1:5 with 5X reaction buffer (New England BioLabs) (0.01 units/µL) ...
-
bioRxiv - Microbiology 2021Quote: ... RNA samples were treated with RNA 5’ Pyrophosphohydrolase (RppH) (New England Biolabs) for 30 min at 37°C ...
-
bioRxiv - Physiology 2019Quote: ... such that following digestion (5 units of AvaII (New England BioLabs, R0153) at 37°C ...
-
bioRxiv - Genetics 2020Quote: ... Mutant Csde1 5’UTRs were cloned by Gibson assembly reaction (NEB, E2621S) using mutation containing ssDNA templates with homology arms and two upstream/downstream fragments.
-
bioRxiv - Genomics 2021Quote: ... 5′ adapter ligation with T4 RNA Ligase 1 (NEB, Ipswich, MA; M0204). The 5’ adaptor contained a 6-nucleotide unique molecular identifier (UMI ...
-
bioRxiv - Biochemistry 2021Quote: ... NH4HCO3 (100 mM) and 5 units of alkaline phosphatase (CIP) (NEB, #M0525S) were added and the sample incubated for 2 hours (or 20 min ...
-
bioRxiv - Microbiology 2021Quote: ... Linker-2 (5′-GAGTCTGCGTGTGATTCGGGTTAGGTGTTGGGTTGGGCCA-3′) was ligated using T4 RNA Ligase1 (NEB). Reaction mixtures were resolved on a 10% TBE-Urea gel ...
-
bioRxiv - Genomics 2021Quote: Purified RNA (5 ug) was reverse transcribed using Random Primer 9 (NEB) and SuperScript II reverse transcriptase under error prone conditions as described Smola et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... transformed into NEB 5-alpha chemically competent Escherichia coli (New England BioLabs), and submitted for Sanger sequencing (Eurofins Genomics ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was transformed into NEB 5-alpha high efficiency competent cells (NEB). Insert size was verified with PCR and purified plasmids were sequenced using Sanger sequencing.
-
bioRxiv - Microbiology 2020Quote: ... 5 μL 2x NEBnext High-Fidelity PCR Master Mix (New England Biolabs) and 2.9 μL nuclease-free distilled H2O (ThermoFisher Scientific) ...
-
bioRxiv - Genomics 2022Quote: ... 5′ adapter ligation with T4 RNA Ligase 1 (NEB, Ipswich, MA; M0204). The 5’ adaptor contained a 6-nucleotide unique molecular identifier (UMI ...
-
bioRxiv - Genomics 2022Quote: ... The 5’ end of the transcript was phosphorylated using PNK (NEB M0201L) and then purified with Trizol (Life Technologies 15596-026) ...
-
bioRxiv - Microbiology 2022Quote: ... T5 exonuclease diluted 1:5 with 5X reaction buffer (New England BioLabs) (0.01 units/µL) ...
-
bioRxiv - Systems Biology 2023Quote: ... The second strand was synthesized using Klenow Fragment (3’ → 5’ exo-) (NEB). The dsDNA library was digested with Mlul-HF and Pad restriction enzymes (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... 20 μL NEBNext 5× Quick Ligation Reaction Buffer (New England Biolabs, UK), and 10 μL of Quick T4 DNA Ligase ...
-
bioRxiv - Microbiology 2022Quote: ... and 5 μL of 800 U/mL proteinase K (New England Biolabs) was added ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 μL of ligation product was then transformed into competent cells (NEB). Transformation and plasmid DNA recovery were performed as previously described ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 μg purified DNA was digested overnight with HinfI and HaeIII (NEB) at 37°C and resolved on a 1% agarose gel ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 μg of total RNA were treated with DNase and CIP (NEB) to remove DNA and all non-capped RNA ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μg 5’PPP transcripts were incubated with 10 U RppH (NEB) and 20 U RiboLock (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Each 5 uL of the reaction contained 0.5 uL of ATP (NEB), 0.5 uL DTT (1 mM final concentration) ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 µL of isolated AAVs were treated with DNAse I (NEB, M0303S) before preparing ten-fold serial dilutions ...
-
bioRxiv - Microbiology 2023Quote: The strain Escherichia coli NEB 5-alpha (New England Biolabs, NEB C2987H) was used as a cloning strain ...
-
bioRxiv - Zoology 2023Quote: ... 5 µl consisting of 1x OneTaq® PCR master mix (NEB, USA), 0 ...
-
bioRxiv - Systems Biology 2023Quote: ... Each construct was transformed into standard 5-alpha competent bacteria (#C2987; NEB) grown overnight in in 500 ml of standard Luria Broth (LB ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were pretreated with homemade PIR-1 or 5’ Pyrophosphohydrolase (RppH, NEB). The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’ ...
-
bioRxiv - Plant Biology 2023Quote: ... 5% (v/v) T4 DNA ligase at 400 U/μL (NEB #M0202), 5% (v/v ...
-
bioRxiv - Biophysics 2023Quote: ... 2.5 mM MgCl2 and 5 mM CaCl2) and digested by MNase (NEB) for 5 min at 25°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... Eluates containing MBP-fusions were applied to 5 mL amylose resin (NEB) columns and extensively washed with 20 mM HEPES pH 7.5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli competent cells (NEB 5-alpha, New England Biolabs, Ipswich, MA, USA) that were cultured and prepared using a GenElute HP Plasmid Midi kit (NA0200-1KT ...
-
bioRxiv - Genomics 2023Quote: ... 10 μL of Digestion-3 mix (5 U NotI-HF (NEB, R3189L) in 1X CutSmart buffer ...
-
bioRxiv - Genetics 2023Quote: ... 2 μL 1 M CaCl2 and 5 μL micrococcal nuclease (NEB, #M0247S) were added and chromatin was fragmented into predominantly mono-nucleosomes by incubation at 37°C for 15 min ...
-
bioRxiv - Biochemistry 2023Quote: ... or HpaII + PmlI (1x NEB CutSmart Buffer, 5 U enzyme/μg DNA) for 1h at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... The DNA was treated with 5 U of Antarctic Phosphatase (NEB #M0289S) for 1h at 37°C in 20 μl reactions ...
-
bioRxiv - Microbiology 2023Quote: ... T5 exonuclease diluted 1:5 with 5X reaction buffer (New England BioLabs) (0.01 units/μL) ...
-
bioRxiv - Microbiology 2023Quote: The strain Escherichia coli NEB 5-alpha (New England Biolabs, NEB C2987H) was used as a cloning strain ...
-
bioRxiv - Genomics 2023Quote: ... and 1 µL of Taq Polymerase (5 U/µL, New England Biolabs) to the CIP reaction ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µL of 10× rCutSmart™ Buffer (New England BioLabs, Ipswich, MA), 10 units each of SalI and EcoRV restriction enzymes (New England BioLabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... before 9 μl of 5 U/μl thermostable RNase H (M0523, NEB) were added and samples were incubated 1 h at 50 °C with 800 rpm shaking (15 s on/15 s off) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 9 μl of 5 U/μl of thermostable RNase H (M0523, NEB) were added and samples were incubated 1 h at 50 °C ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μL of 2X protein synthesis buffer (New England Biolabs, Beverly, MA), 0.25 μL of RNaseOUT RNAse inhibitor (Thermo-Fisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... The mixtures were mixed with 5 µl RNA dye (New England Biolabs) and separated by 12% TBE PAGE ...
-
bioRxiv - Cell Biology 2023Quote: ... Digested DNA was treated with Klenow Fragment (3’→5’ exo-) (NEB, M0212) in a final volume of 250 µL of 1x NEBNext dA-tailing reaction buffer (NEB) ...
-
bioRxiv - Biophysics 2023Quote: ... followed by 5’-end phosphorylation with T4 PNK (New England Biolabs, NEB) and simultaneous blunt ligation of the plasmid using T4 DNA ligase (NEB) ...
-
bioRxiv - Biophysics 2023Quote: ... followed by 5’-end phosphorylation with T4 PNK (New England Biolabs, NEB) and simultaneous blunt ligation of the plasmid using T4 DNA ligase (NEB) ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting 5’ biotinylated PCR products were digested with BsaI-HF (NEB) to generate four base-pair overhangs ...
-
bioRxiv - Cell Biology 2023Quote: ... and for A-tailing with Klenow Fragment (3’->5’ exo–) (NEB; M0212). A biotinylated primer (ENDseq-adaptor-1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... dinucleotide primers were 5’-labeled using T4 polynucleotide kinase (New England Biolabs) and added at 20 µM without pre-annealing to the template ...