Labshake search
Citations for New England Biolabs :
851 - 900 of 7411 citations for Acetamide N 2 3 dihydro 2 3 hydroxy 2 quinolinyl 1 3 dioxo 1H inden 5 yl since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2021Quote: ... 1 µL of 10mM dNTPmix and 2 µL of Phusion polymerase (NEB). PCR products were purified using the QIAquick PCR purification column and eluted with 30 µL Qiagen Elution Buffer ...
-
bioRxiv - Microbiology 2021Quote: ... 7 μl PEG8000 and 1 μl T4 RNA ligase 2 K227Q (NEB) at 25 °C for 1 h ...
-
bioRxiv - Bioengineering 2022Quote: ... 1X of a restriction enzyme mix [1/2 EcoRI-HF® (NEB #R3101 ...
-
bioRxiv - Biophysics 2022Quote: ... 2 μL of a 0.4 µg µL-1 stock of Trypsin (NEB) were added to the samples (to a final enzyme:substrate ratio of 1:50 w/w ...
-
bioRxiv - Genetics 2022Quote: ... were ligated using a 1:2 mixture of T4 ligase (NEB, M0202L) and T4 polynucleotide kinase (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µl of 100µM DTT and 1 µl of NudC (M0607S, NEB), then incubated for 30 min at 37°C ...
-
bioRxiv - Genomics 2023Quote: ... dsDNA was digested by MmeI solution (1× NEB Cutsmart, 2 U MmeI) at 37 °C for 0.5 h and extracted with 12% native polyacrylamide TBE gel (∼84 bp band) ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of 10 mM MnCl2 and 1-2 μl (400-800 units) of λ PP (New England Biolabs, Ipswich, MA). Untreated lysates received 1-2 μl of water in place of λ PP ...
-
bioRxiv - Physiology 2024Quote: ... the following reagents were added to each tube containing 1 cell in ∼5 μL: 2 μL M-MuLV Reverse Transcriptase Reaction Buffer (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 uL aliquots were removed at each time point and added to 2 uL 5 mg/mL Proteinase K (NEB) in 5% SDS ...
-
bioRxiv - Immunology 2021Quote: ... the samples were added to 2 μL of second-strand synthesis mix containing 2.25× NEB buffer 2 (NEB), 0.625mM each dNTP Mixture (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... The purified products were subjected to dA tailing with 2 μL of 10X NEBuffer 2 (New England BioLabs), 0.1 μL of 100 mM dATP ...
-
bioRxiv - Biochemistry 2024Quote: ... the reaction described above included another 2 µL of mRNA cap 2′-O-methyltransferase (50 U/µL, NEB). The capping reaction was incubated at 37°C for 4 h ...
-
bioRxiv - Genetics 2021Quote: ... including 8 bp barcode and P5 overhang (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCATCTTTGTGGAAAGGACGAAA CACCG-3’) using the Q5 Hot Start High-Fidelity polymerase (NEB #M0494S) for 22-24 cycles ...
-
bioRxiv - Molecular Biology 2021Quote: Telomeric duplex DNA 5′-GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGCCCCTC-3′ and antisense (5′-GAGGGGCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC-3′ was end-labeled with [γ-32P]ATP (Amersham Biosciences) and T4-polynucleotide kinase (New England BioLabs) and purified from free nucleotides through G25 spin columns (GE Healthcare) ...
-
bioRxiv - Cell Biology 2022Quote: ... The mixture was incubated for 3 days at 37 °C in the dark for conjugation and purified for 3 rounds using Monarch® PCR & DNA Cleanup Kit (5 μg) (Cat# T1030S, NEB) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted at 1,000 x g for 5 min at 4°C then resuspended in 450 μl of 1X NEBuffer 3 (NEB, cat. # B7003S). Primary restriction enzyme digestion of intact nuclei was carried out overnight at 37°C using 50,000 U of DpnII (NEB ...
-
bioRxiv - Genomics 2022Quote: ... an adenylated 5’ end and a dideoxycytosine blocked 3’end – was ligated to size-selected small RNAs using T4 Rnl2tr K227Q (NEB, M0351L) for 16 hours at 25°C ...
-
bioRxiv - Genomics 2020Quote: ... The PCR product and pGAD-C1 vector were digested with ClaI (5’-ATCGAT-3’, New England BioLabs Inc., MA, CA#R0197S) and SalI (5’-GTCGAC-3’ ...
-
bioRxiv - Genomics 2021Quote: Capping with 3’ Desthiobiotin GTP (DTB-GTP) was performed in 50 µl total volume with 5 µL Vaccinia capping enzyme (NEB M02080) and 0.5 mM DTB-GTP (NEB N0761) ...
-
bioRxiv - Cell Biology 2021Quote: ... The library was PCR amplified using universal primers that annealed to the common flanking sequence and appended homologous sequences at 5’ and 3’ ends of the PCR product to enable Gibson assembly (New England Biolabs E2611) into pZLCv2_puro_1KF ...
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
bioRxiv - Developmental Biology 2022Quote: ... fluorescent protein mCherry sequence and self-cleaving P2A peptide sequence (5’HA-H2B-mCherry-P2A-3’HA) in a pUC19 vector backbone using Gibson Assembly (New England Biolabs (NEB), E5510S) ...
-
bioRxiv - Microbiology 2020Quote: ... The 3’ends of end-repaired DNA were extended with an A-overhang with 3’ to 5’ exonuclease-deficient Klenow DNA polymerase (NEB, M0212L). The resulting fragments were ligated to Nextflex 6bp adaptors (Bio Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... DNA template for the assay was generated by annealing a primer (5′-CCCAGTCACGACGTTGTAAAACG-3′) to M13mp18 single-stranded DNA (New England Biolabs, N4040S). The assay was initiated by incubation of 1nM of DNA template with 1 mM ATP ...
-
bioRxiv - Genomics 2022Quote: ... blunt DNA fragments on the beads were adenine-tailed by adding 7μl of Klenow 3’→5’ exo-polymerase 5U/μl (New England Biolabs cat. #M0212L), 2.3μl of dATP 10mM and 5 μl NEB2 of 10x NEBuffer 2 and incubating the mixture 30 minutes at 37ºC and a further 10 minutes at 65ºC to inactivate the enzyme.
-
bioRxiv - Microbiology 2022Quote: ... The resulting double-stranded oligos had 5’ extensions that were complementary to the non-palindromic 3’ overhangs generated by BsaI-HFv2 (NEB, R3733) digestion of pJJW101 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reaction underwent ethanol precipitation as described above and the precipitated DNA was suspended in 32 μl Elution buffer and used in a 50 μl A-tailing reaction using Klenow (3’→5’ exo-) (NEB, M0212), incubated at 37°C for 30 min ...
-
bioRxiv - Microbiology 2022Quote: ... 8 candidate Envs containing variations of signature mutations were synthesized by Synbio Technologies and were cloned into the SHIV.3C backbone using the BsmBI restriction sites at the 5’ and 3’ end of the CH505 Env cassette and then ligated together using T4 ligase (New England Biolabs #M0202S). 8 plasmids encoding full-length SHIV.C.CH505 combination clones were used to transfect 293T cells as described above ...
-
bioRxiv - Molecular Biology 2023Quote: ... barcoded 5’ -pre-adenylated linkers were added to the 3’ ends of footprints using T4 Rnl2(tr) K227Q (New England Biolabs, M0351S), and excess unligated linker was removed using 10 U/µl 5’ deadenylase/RecJ exonuclease (Epicentre ...
-
bioRxiv - Molecular Biology 2023Quote: ... Small RNAs were treated with 5′ RNA polyphosphatase (Epicenter RP8092H) and ligated to 3′ pre-adenylated adapters with Truncated T4 RNA ligase (NEB M0373L). Small RNAs were then hybridized to the reverse transcription primer ...
-
bioRxiv - Plant Biology 2023Quote: ... and MpERF20 cds in situ R (5’ GTACAAGAAAGCTGGGTCGGCGCGCCttacatgagtgggggaactaaaagaagagt-3’) and seamlessly cloned using NEBuilder HiFi DNA Assembly (New England Biolabs, #E5520) into pENTR-D linearized with NotI/AscI ...
-
bioRxiv - Microbiology 2023Quote: ... and vcircRNA873/1151 (oligonucleotide probe 5’- CAGGACAACAGGGCCAGCAAGGTGGCGGACATCACAACCA-3’ against the junction) were performed using γ-32P-dATP-end labeled (PNK kinase, NEB) probes ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 3.3 kb DNA sequence upstream of each respective gene was amplified using PCR and cloned into the vector containing the sequence gfp::rab-7::rab-7 3’UTR amplified from plasmid rgef-1p::gfp::rab-7::rab-7 3’UTR using PCR and primers 5’-atgagtaaaggagaagaacttttca-3’ and 3’-aagcttatcgataccgtcgac-5’ were used to generate tissue-specific gfp::rab-7::rab-7 3’UTR by using Gibson assembly (NEB E2611).
-
bioRxiv - Biochemistry 2024Quote: The library was prepared following our previously reported procedure with slight changes.[21] 3′-End repair and 5′-phosphorylation were conducted with T4 polynucleotide kinase (PNK) (NEB, M0201S). 16 µL RNA was mixed with 2 µL 10× T4 PNK reaction buffer and 1 µL T4 PNK ...
-
bioRxiv - Microbiology 2024Quote: ... The mixture was incubated for 3 days at 37C in the dark for conjugation and purified for 3 rounds using Monarch PCR & DNA Cleanup Kit (5 µg) (NEB, T1030S) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... Small RNAs were treated with 5’ RNA polyphosphatase (Epicenter RP8092H) and ligated to 3’ pre-adenylated adapters with Truncated T4 RNA ligase (NEB M0373L). Small RNAs were then hybridized to the reverse transcription primer ...
-
bioRxiv - Cancer Biology 2024Quote: ... ChIP–seq libraries were prepared from 3–5 ng of ChIPed DNA using NEBNext Ultra II DNA Library Prep Kit (NEB, E7645S), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... The aliquots were then divided into 3 digest reactions of 5 M cells and digested with the NlaIII restriction enzyme (NEB, R0125L). After subsequent proximity ligation and DNA extraction ...
-
bioRxiv - Molecular Biology 2021Quote: ... Ribosome protected RNA fragments were 3’ dephosphorylated with T4 polynucleotide kinase (NEB) in 150 mM MES-NaOH pH 5.5 ...
-
bioRxiv - Genomics 2021Quote: ... and 150 μg chromatin was immunoprecipitated using 3 μg H3K18la (PTM Biolabs) overnight at 4°C with gentle rotation (20 rpm ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 3 μL DNase I (both New England Biolabs, Ipswich, MA, USA) was added to 30 μL of the mixture and incubated for 22 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3’ end dephosphorylation was performed with T4 polynucleotide kinase (New England Biolabs) before addition of a pre-adenylated linker using RNA ligase (New England Biolabs) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3.5 µL of 3 U/µL T4 DNA Polymerase (New England Biolabs) was added to each sample ...
-
bioRxiv - Molecular Biology 2022Quote: About 3 μg plasmid was digested with 20 units SapI (NEB, R0569) and dephosphorylated with 3 units rSAP (NEB ...
-
bioRxiv - Physiology 2022Quote: ... and 3 U of DNAse I (catalog no. M0303, New England BioLabs) were added per ml of mix ...
-
bioRxiv - Molecular Biology 2022Quote: ... The modified pcDNA3-3×-FLAG have been digested with EcoRI & NotI (NEB) and the pcDNA3-V5 vector has been digested with KpnI & BamHI ...
-
bioRxiv - Genetics 2020Quote: ... 3’-end RNA dephosphorylation was performed on beads with PNK (NEB M0201L) for 20 min at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 3 µl Ultra II End-prep enzyme mix (New England Biolabs). Samples were incubated at 20°C for 5 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3’ adaptor was ligated to the cDNA using T4 ligase (NEB; M0202S). The cDNA was purified using Dynabeads myOne SILANE (life Technologies ...