Labshake search
Citations for New England Biolabs :
851 - 900 of 4511 citations for 8 DECYLOXYPYRENE 1 3 6 TRISULFONIC ACID TRISODIUM SALT since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... Zyagen samples were amplified with PBC096 barcoding for 8-10 cycles with both LongAmp (female, 62°C annealing; NEB, US) and PrimeSTAR GXL (male and female ...
-
bioRxiv - Genomics 2022Quote: ... CRISPEY-BAR barcodes integrated in the genome were amplified with a first step PCR in 8 tubes of 50 uL reactions using Q5 hot-start DNA polymerase (New England Biolabs) following manufacturer recommendations ...
-
bioRxiv - Immunology 2022Quote: ... Iso-Seq libraries were generated using 500 ng high-quality (RIN > 8) RNA as input into oligo-dT primed cDNA synthesis (NEB). Barcoded primers were incorporated into the cDNA during second strand synthesis ...
-
bioRxiv - Biochemistry 2023Quote: Transcription reactions were prepared at room temperature in 20 µL transcription buffer (40 µM Tris-HCl pH 8, 5 mM DTT, 10 mM MgCl2) with 2 mM NTP’s (NEB, N0450S) and 40 U/µL RNasin™ Plus (Promega ...
-
bioRxiv - Cell Biology 2023Quote: ... Coding sequences of ric-8 and nphp-2s were amplified from a mixed-stage N2 cDNA library using Phusion high-fidelity DNA polymerase (NEB) with gene-specific primers and verified by Sanger sequencing.
-
bioRxiv - Genomics 2023Quote: ... Samples were diluted in 8 ml of T4 DNA ligase buffer 1X and incubated 8 hours at 16°C with 8000 Units of T4 DNA ligase (NEB). Crosslinks were reversed overnight at 60°C in the presence of proteinase K (0.125 mg / ml final ...
-
bioRxiv - Cancer Biology 2023Quote: ... Amplification with barcoded primers was performed with a few numbers of PCR cycles (5 to 8) and a high-fidelity polymerase (Q5, NEB). Amplified libraries were size-selected on a non-denaturing 8% acrylamide gel and purified ...
-
bioRxiv - Molecular Biology 2023Quote: ... was also reverse-transcribed and Illumina sequencing library prep was followed by 8–10 cycles of polymerase chain reaction (PCR) using High Fidelity Phusion (New England Biolabs). All the libraries were barcoded in the PCR step ...
-
bioRxiv - Systems Biology 2023Quote: ... Each library was dissolved in 100µL Tris 10mM pH 8 and amplified by PCR with specific primers (Fw: GTGAACCGTCAGATCGCCTCGGCACTCCAGTCCT, Rv: AGAGGGTTAGGGATAGGCTTACCTCAGGCTAGTGCGGACCGAGTCG) using NEBNext Ultra II Q5 HotStart (NEB). PCR cycling parameters were set as follows ...
-
Bio-orthogonal Glycan Imaging of Culture Cells and Whole Animal C. elegans with Expansion MicroscopybioRxiv - Bioengineering 2024Quote: ... Recombinant Muc1 or lubricin mixed with one of the following enzymes: 8 unit/mL of proteinase K (P8107S, New England Biolabs), 500 μg/mL of pronase (10165921001 ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were diluted in 8 ml of T4 DNA ligase buffer 1X and incubated 8 hours at 16°C with 8000 Units of T4 DNA ligase (NEB). Crosslinks were reversed overnight at 60°C in the presence of proteinase K (0.125 mg / ml final ...
-
bioRxiv - Genomics 2023Quote: ... The resulting digested DNA (4 ml in total) was divided into four aliquots and diluted in 8 ml of ligation buffer (1X ligation buffer NEB without ATP ...
-
bioRxiv - Genomics 2024Quote: ... dATP (3x 1.5 µL of 10 mM solutions) and 8 µL of 5 U/µl Klenow fragment of DNA polymerase I (New England Biolabs) and a 30-minute incubation at 37°C with rotation ...
-
bioRxiv - Genomics 2024Quote: ... Genomic DNA was harvested by discarding culture media and adding lysis buffer consisting of 20 mM Tris pH 8 and 0.1% Triton X-100 (MilliporeSigma T9284) with 60 ng/mL of Proteinase K (New England Biolabs P8107S) added immediately prior to use ...
-
bioRxiv - Molecular Biology 2020Quote: ... 20 ng of DNA was digested with 6 to 12 U of the restriction enzyme PvuII (NEB) overnight at 37°C.
-
bioRxiv - Genomics 2020Quote: ... DNA libraries were amplified by PCR for 6-10 cycles with Phusion HF DNA Polymearse (NEB, M0530) using Illumina TruSeq indexing primers for multiplexing ...
-
bioRxiv - Cell Biology 2020Quote: ... Images were collected every 10 mins for up to 6 days and the timing of events (NEB, the start of cytokinetic furrow ingression and the appearance of 2 distinct cells ...
-
bioRxiv - Microbiology 2019Quote: ... the product was cloned into the pET1-5b N-terminal 6×His expression plasmid (New England Biolabs).
-
bioRxiv - Microbiology 2023Quote: ... Desialylation of Calu-3 cells was achieved by incubating cells grown in a 96 well plate or 24-well plate or 6 well plate with 100 U/mL α2-3,6,8,9 neuraminidase A (P0722L, NEB) in 10% FCS media for 3 h at 37°C ...
-
bioRxiv - Biochemistry 2022Quote: ... reactions were performed with 6 μl of PURExpress ΔRF123 in vitro protein synthesis system (New England Biolabs) in the presence of 1x RF3 ...
-
bioRxiv - Biophysics 2023Quote: ... and the DNA of the SL5-6 domains was then digested using BsaI (New England Biolabs #R0535) followed by Mung Bean Nuclease (New England Biolabs #M0250) ...
-
bioRxiv - Systems Biology 2019Quote: ... Each of the four-nucleic acid substrates were radiolabeled with [γ-32P]-ATP using T4 Polynucleotide Kinase (NEB). Free nucleotide was removed using G-25 MicroSpin columns (GE Healthcare) ...
-
bioRxiv - Biochemistry 2020Quote: ... Amino acid substitutions were made using the Q5 Site-directed Mutagenesis kit (New England Biolabs, Ipswich, MA, USA) to generate pNG309 and pNG307 for expression of xoxF1 D320A and exaF D319S ...
-
bioRxiv - Molecular Biology 2022Quote: ... Removal of sialic acids was performed using the α2-3,6,8 neuraminidase (New England Biolabs, 50 U/μg protein). Removal of fucose was performed using α1-2,4,5,6 fucosidase O (New England Biolabs ...
-
bioRxiv - Genetics 2022Quote: ... or FLAG (amino acid sequence: DYKDDDDK) with a kit (Gibson assembly kit from New England Biolabs, catalogue # E5510S). The different combinations were cloned into pJFRC7-20XUAS-IVS-mCD8::GFP (Addgene # 26220 ...
-
bioRxiv - Biophysics 2021Quote: ... of 0.1M sodium hydroxide: 0.02M 2-(n-morpholino) ethanesulfonic acid (MES) or 1X NEB DNase I reaction buffer (NEB B0303S ...
-
bioRxiv - Microbiology 2022Quote: ... Amino acid substitutions in pCDNA3-HA-CoV2-Nsp1 vector were introduced using Phusion PCR mutagenesis (New England Biolabs) to generate pCDNA-HA-CoV2-Nsp1(R99A ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 nM okadaic acid (Enzo LifeSciences, ALX-350-011-M001) 50 U micrococcal nuclease (New England Biolabs, M0247S)) ...
-
bioRxiv - Cell Biology 2020Quote: 3′ linker ligation (1x PNK buffer, 20 U T4 RNA ligase I (NEB), 20 U T4 RNA Ligase II truncated K227R ...
-
bioRxiv - Cell Biology 2020Quote: ... the old H4-SNAP pool was first quenched with 3 μM BTP (NEB) for 30 min in complete medium ...
-
bioRxiv - Genomics 2020Quote: ... and 3 μL of Uracil-Specific Excision Reagent (USER) Enzyme (NEB, Beijing, China) was then used with the size-selected and adaptor-ligated cDNA at 37°C for 15 min ...
-
bioRxiv - Systems Biology 2022Quote: ... total RNA was first ligated to adaptors at the 3’ end by NEB 3’ SR adaptor and 5’ end by T4 RNA ligase followed by reverse transcription into cDNA using M-MuLV Reverse Transcriptase ...
-
bioRxiv - Immunology 2022Quote: ... plates were washed 3 times with PBS-T and TMB substrate (Denovo Biolabs) was added for development of color ...
-
bioRxiv - Genomics 2020Quote: ... 4 μL of 3 U/μL NEB T4 DNA Polymerase (New England Biolabs), 1 μL of 5U/μL Klenow (New England Biolabs) ...
-
bioRxiv - Genomics 2019Quote: ... The mixture was supplemented with 5 µL DNA polymerase (3 U/µL, NEB) and 6 µL Klenow (5 U/µL ...
-
bioRxiv - Genetics 2020Quote: ... 3 µl of dNTPs (2.5 mM each) and 5 U Klenow exo- (NEB) and incubating for 1 h at 30°C ...
-
bioRxiv - Biochemistry 2021Quote: 100 μl extension reactions were performed with Klenow Fragment (3’→5’ exo-) (NEB) (Figures 2B ...
-
bioRxiv - Biophysics 2021Quote: ... where GRN-3 was expressed in Escherichia coli SHuffle cells (New England Biolabs) while other GRNs were expressed in Origami 2 DE3 cells (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... The reaction was supplemented with 3 μl of T4 RNA ligase I (NEB), 1.5 μl of 10X reaction buffer ...
-
bioRxiv - Biophysics 2021Quote: ... and poly(A)-tailed at their 3’ ends with poly(A) polymerase (NEB), following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... then perform A-tailing with Klenow Fragment (3’-> 5’ exo-) (NEB, Cat. M0212S) provided with dATP ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was removed 3’phosphoryl groups using T4 Polynucleotide Kinase (New England Biolabs) in the buffer (70 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 ng of DNA was used per qPCR reaction (qPCR Master Mix, NEB). PCR was performed using an Applied Biosystems 7500 instrument (software version 2.3) ...
-
bioRxiv - Genomics 2019Quote: ... and 3 µl of NEBNext Ultra II End Prep Enzyme Mix (E7545L, NEB) were mixed gently in 1.5 ml Eppendorf tube ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ phosphorylation and 3’ dephosphorylation were performed with T4 PNK (NEB, Cat: M0201S) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and A-tailed using Klenow 3’-5’exo-enzyme (NEB, Cat. No. M0212). Illumina sequencing library adapters were subsequently ligated to DNA ends ...
-
Glucocorticoid receptor collaborates with pioneer factors and AP-1 to execute genome-wide regulationbioRxiv - Genomics 2021Quote: ... In-line barcoded 3′ adapters were ligated with T4 RNA ligase I (NEB) for 12 hours at 20°C ...
-
bioRxiv - Genomics 2022Quote: ... and 3’-adenylated with NEBNext Ultra II End Repair/dA-Tailing Module (NEB). The DNA was then purified with AMPure XP beads (Beckmann Coulter ...
-
bioRxiv - Molecular Biology 2022Quote: ... pUC19-3’ITR-3xCTCF- rHA was linearized with KpnI and HindIII (NEB, R3104L) and the Neomycin resistance gene was amplified from pEN113 (Addgene ...
-
bioRxiv - Genomics 2022Quote: ... and 3 µL 5U/µL DNA Polymerase I Large (Klenow) Fragment (NEB, #M0210V) was added and incubated at 37°C for 45min with rotation ...