Labshake search
Citations for New England Biolabs :
851 - 900 of 3651 citations for 8 5 HEXYL 2 FURYL OCTANOIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: The pVecBar-Rht13 construct contained a 6,998 bp fragment including 2,532 bp upstream and 450 bp downstream regions amplified from Magnif mutant genomic DNA using primers Rht13-NotF2 (5’ AATGCGGCCGCAATCGATAGGAGAGCTGCGTCTGTGTG 3’) and Rht13-AscR2 (5’ TGCGTACGGCGCGCCGAGAGTCGCCTTGCCAGTTC 3’) with Phusion® High-Fidelity DNA Polymerase (NEB, USA). pVecBarIII is a derivative of pWBvec8 (Wang et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... The G4 sequence and larger 5′ UTR (three human β-globin 5′ UTR sequences in tandem) were inserted using the Q5 Site-Directed Mutagenesis Kit (NEB # E0552S). pcDNA3.1(+)/mEGFP was a kind gift from Jeremy Wilusz (Baylor College of Medicine) ...
-
bioRxiv - Genetics 2023Quote: The yeast plasmids recovered after thermoselection were subject to a shortened PCR with 15 cycles with oligonucleotide pairs oWS1408 (5°-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCAGCATATAATCCCTGCTTTA-3°) and oWS1409 (5°-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTCCAGGGGTGGTGCAAACTATG-3°) using a high-fidelity Q5 polymerase (New England Biolabs, Ipswich, MA) to attach overhang sequences ...
-
bioRxiv - Biochemistry 2023Quote: ... and “frq segment 4F” (5’-CACCGATCTTTCAGGAGACCCTG-3’) and “frq segment 4R” (5’-CACTCAGGTC TCAATGGTGA TG-3’) pair with pCB05 digested with FseI (NEB, Catalog # R0588S) and MluI (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... “frq segment 3F” (5’-GTCGCACTGGTAACAACACCTC-3’) and “frq segment 3R” (5’-CAGCACATGTTCAACTTCATCAC-3’) were designed for pCB05 digested with NruI (NEB, Catalog # R0192S) and FseI (NEB ...
-
bioRxiv - Genetics 2023Quote: ... 10 µg of the K3L variant library was digested with 5 µL of BstEII-HF and 5 µL SacI-HF (NEB Cat#R3156S) in a 50 µL reaction to generate a linear insert fragment of approximately 1130bp ...
-
bioRxiv - Biophysics 2024Quote: ... First the 5’ triphosphate of RNA was converted into a 5’ monophosphate by incubating 100 µg RNA with 100 units of RNA 5’ Pyrophosphohydrolase (NEB, Ipswich MA) at 37°C for 1 hour within a 100 µl reaction volume ...
-
bioRxiv - Systems Biology 2019Quote: ... Each of the four-nucleic acid substrates were radiolabeled with [γ-32P]-ATP using T4 Polynucleotide Kinase (NEB). Free nucleotide was removed using G-25 MicroSpin columns (GE Healthcare) ...
-
bioRxiv - Biochemistry 2020Quote: ... Amino acid substitutions were made using the Q5 Site-directed Mutagenesis kit (New England Biolabs, Ipswich, MA, USA) to generate pNG309 and pNG307 for expression of xoxF1 D320A and exaF D319S ...
-
bioRxiv - Molecular Biology 2022Quote: ... Removal of sialic acids was performed using the α2-3,6,8 neuraminidase (New England Biolabs, 50 U/μg protein). Removal of fucose was performed using α1-2,4,5,6 fucosidase O (New England Biolabs ...
-
bioRxiv - Genetics 2022Quote: ... or FLAG (amino acid sequence: DYKDDDDK) with a kit (Gibson assembly kit from New England Biolabs, catalogue # E5510S). The different combinations were cloned into pJFRC7-20XUAS-IVS-mCD8::GFP (Addgene # 26220 ...
-
bioRxiv - Microbiology 2022Quote: ... Amino acid substitutions in pCDNA3-HA-CoV2-Nsp1 vector were introduced using Phusion PCR mutagenesis (New England Biolabs) to generate pCDNA-HA-CoV2-Nsp1(R99A ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 nM okadaic acid (Enzo LifeSciences, ALX-350-011-M001) 50 U micrococcal nuclease (New England Biolabs, M0247S)) ...
-
bioRxiv - Genomics 2021Quote: ... 5’-deadenylase (Cat. No. M0331S; NEB; use 0.5 uL), PEG 8000 (final concentration = 10% (w/v)) ...
-
bioRxiv - Cell Biology 2020Quote: ... an oligonucleotide was 5’-labeled using PNK enzyme (NEB). The ITS2 probe was previously reported (Donati et al. ...
-
bioRxiv - Genomics 2021Quote: ... 5 U of Klenow Fragment (New England Biolabs, M0210) were added and incubated at 25°C for 20 minutes ...
-
bioRxiv - Genomics 2022Quote: ... 5 units (50 Gel Units) of Micrococcal Nuclease (NEB) were added to one tube and 20 units (200 Gel Units ...
-
bioRxiv - Molecular Biology 2020Quote: ... Un-reacted linkers were digested with 5’ deadenylase (NEB) and RecJ exonuclease (epicentre ...
-
bioRxiv - Genomics 2020Quote: ... 5′ end phosphorylation using T4 polynucleotide kinase (NEB, M0201L), (4 ...
-
bioRxiv - Genomics 2019Quote: ... and 5 U exo-Klenow Fragment (New England Biolabs) for 1 h at 37 C followed by incubation with 80 U of TaqDNA ligase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: ... Un-reacted linkers were digested by 5’ deadenylase (NEB) and RecJ exonuclease (epicentre ...
-
bioRxiv - Molecular Biology 2019Quote: ... followed by incubation with Antarctic Phosphatase (NEB, 5 U) for an additional 2 hours at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... 4 mM adenosine-5’-triphosphate (ATP) (New England Biolabs); 2 mM each of guanosine-5’-triphosphate (GTP) ...
-
bioRxiv - Biophysics 2019Quote: 5 µg of commercially prepared λDNA (New England Biolabs) was incubated with 0.025 U of Nt.BbvC1 in a final volume of 100 µl of 1 X CutSmart buffer (New England Biolabs ...
-
bioRxiv - Microbiology 2019Quote: ... and retransformed into chemically competent NEB 5-alpha (NEB) to improve yields ...
-
bioRxiv - Genomics 2019Quote: ... 3’-adenylation (Klenow Fragment 3’ to 5’ exo-, NEB), and ligation of indexed sequencing adaptors (Quick Ligation kit ...
-
bioRxiv - Genomics 2019Quote: ... and contained 5 μL of Q5 PCR buffer (NEB), 0.0625 μL of 100 μM universal forward primer ...
-
bioRxiv - Genomics 2019Quote: ... and contained 5 μL of Q5 PCR buffer (NEB), 0.0625 μL of 100 μM universal forward primer ...
-
bioRxiv - Molecular Biology 2020Quote: 5 μl Bst 3.0 (NEB, M0374L, 8,000 units/ml),
-
bioRxiv - Microbiology 2020Quote: ... 40 nmol ATP and 5 U RppH respectively (NEB). After each enzymatic treatment ...
-
bioRxiv - Molecular Biology 2020Quote: ... by Klenow fragment (3’→5’ exo-) (NEB, Ipswich, MA) for 30 min at 37 °C ...
-
Role of the Topoisomerase IIα Chromatin Tether domain in Nucleosome Binding & Chromosome SegregationbioRxiv - Cell Biology 2021Quote: ... 5 mM CaCl2) with MNase (#M0247S, New England Biolabs). The obtained digest (mononucleosomes ...
-
bioRxiv - Microbiology 2020Quote: ... at the 5’ end and NotI (New England Biolabs) at the 3’ end ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5’ end-labeled using T4 polynucleotide kinase (NEB) and [γ-32P] ATP ...
-
bioRxiv - Molecular Biology 2022Quote: ... was added with 5 μl CutSmart Buffer (NEB, B7204) and digested for 2 hours at 37 °C ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μl of 5X Q5 Reaction Buffer (NEB, M0493S), and water to bring to 25 μl ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli strains: NEB 5-alpha (NEB C2987, not authenticated), BL21-AI (ThermoFisher C607003 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 µl of 10U/µl NEB T4 PNK (NEB), 4 µl of 3U/µl NEB T4 DNA polymerase (NEB) ...
-
Targeted attenuation of elevated histone marks at SNCA alleviates α-synuclein in Parkinson’s diseasebioRxiv - Neuroscience 2020Quote: ... which already contained 5 ml Nuclear Extraction Buffer (NEB; 0.32 M Sucrose ...
-
bioRxiv - Neuroscience 2020Quote: ... comprising 6 mM 5’ cap analog (New England Biolabs), 7.5 mM adenosine triphosphate and 1.5 mM guanosine triphosphate (USB ...
-
bioRxiv - Microbiology 2022Quote: ... or 5 µg pTOPO dsRNA plasmids with EcoR1 (NEB) in reaction containing 1X T7 buffer (50mM Tris-HCl ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 5 U/μl protoscript II reverse transcriptase (NEB, M0368X), 1x protoscript II reverse transcriptase buffer ...
-
bioRxiv - Biochemistry 2019Quote: ... and buffer (5× diluted final concentration, New England Biolabs), DMSO (10% v/v final concentration) ...
-
Removal of Spo11 from meiotic DNA breaks in vitro but not in vivo by Tyrosyl DNA Phosphodiesterase 2bioRxiv - Molecular Biology 2019Quote: ... 15 units of Klenow (3′→5 ′ exo–) polymerase (NEB) with 66 nM dNTPs for 30 minutes at 30°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 0.15 U Klenow Fragment (3’→5’ exo-) (NEB) in 1X NEBuffer 2 at 37°C for 30 minutes (cite) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 5’ RNA adaptor (NEB, sequence see Table S4) by T4 RNA ligase 1 (NEB) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 5μL Klenow Fragment (3′->5′ exo-, NEB, N0202S) for A-tailing were added at 37°C for 40 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... A-tailed with Klenow 3’ to 5’ exo-(NEB), ligated to Illumina Truseq LT adaptors using Quick Ligase enzyme (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μg purified LbCas12a (New England BioLabs, catalog# M0653T) was incubated with equal molar purified gRNA (near 0.5 μg ...
-
bioRxiv - Genetics 2020Quote: ... 3 μL 5× Phusion HF buffer (New England Biolabs), 2.7 μL dH2O ...