Labshake search
Citations for New England Biolabs :
851 - 900 of 2132 citations for 7 Chloro quinazoline 2 4 diamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µM IllLigBio adapter pre-adenylated using a 5’ adenylation kit (NEB), 20-200 nM pppUGAAUG hexamer standard ...
-
bioRxiv - Microbiology 2022Quote: ... 2 μL of NEBNext FFPE DNA Repair Mix (New England Biolabs, UK), 3.5 μL Ultra II End-prep reaction buffer ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μg 5’PPP transcripts were incubated with 10 U RppH (NEB) and 20 U RiboLock (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2023Quote: ... 2 µL BsaI-HF v2 Golden Gate enzyme mixture (New England Biolabs), 4 µL 10× T4 Ligase buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2 units/µl of murine RNase inhibitor (New England Biolabs, M0314L). In minigene experiments ...
-
bioRxiv - Developmental Biology 2023Quote: ... Digestion was performed with 2 µl (10U) of thermostable RNaseH (NEB #M0523S) and 2 µl of 10X buffer in a 20 µl volume at 65° C for 5 min ...
-
bioRxiv - Genomics 2023Quote: ... and 2 µl CutSmart buffer (New England Biolabs, cat. no. B7204S, 10×) at 37°C for 2h ...
-
bioRxiv - Genomics 2023Quote: ... dsDNA was digested by MmeI solution (1× NEB Cutsmart, 2 U MmeI) at 37 °C for 0.5 h and extracted with 12% native polyacrylamide TBE gel (∼84 bp band) ...
-
bioRxiv - Biochemistry 2023Quote: ... 15% PEG8000 and 20 U T4 RNA ligase 2 truncated KQ (NEB)) ...
-
bioRxiv - Biochemistry 2023Quote: ... of the SARS-CoV-2 Positive Control (N gene) plasmid (NEB N2117). Sanger sequencing confirmed successful mutagenesis ...
-
bioRxiv - Genetics 2023Quote: ... the probe was digested by 2 units of DNaseI (New England Biolabs) at 37 °C for 30 min ...
-
bioRxiv - Genetics 2023Quote: ... 2 μL 1 M CaCl2 and 5 μL micrococcal nuclease (NEB, #M0247S) were added and chromatin was fragmented into predominantly mono-nucleosomes by incubation at 37°C for 15 min ...
-
bioRxiv - Genetics 2023Quote: ... 2 μL RNase inhibitor (M0314; New England Biolabs Inc.; Ipswich MA, USA) and 2 μL MNase (M0247 ...
-
bioRxiv - Genetics 2023Quote: ... and 2 μL MNase (M0247; New England Biolabs Inc.; Ipswich MA, USA) were mixed in and tubes promptly placed on ice ...
-
bioRxiv - Microbiology 2023Quote: ... for 30 min and 2 μl Proteinase K (New England BioLabs, P8107S) for 1 h ...
-
Higher meiotic chromosome condensation: a potential function of kinetochore through polo-like kinasebioRxiv - Cell Biology 2023Quote: ... The diluted sample was treated with 2 µl Lambda protein phosphatase (NEB) and incubated in water bath at 30 °C for 4 hrs ...
-
bioRxiv - Microbiology 2023Quote: ... SARS-CoV-2 DNA fragment plasmids were digested with I-SceI (NEB) to release the overlapping fragments from the backbones ...
-
bioRxiv - Molecular Biology 2023Quote: ... at 37 °C for 2 hours followed by digestion with PspXI (NEB) in rCutsmart™ Buffer (NEB ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 and 3 were assembled by PCR assembly using Vent polymerase (NEB), with each reaction consisting of 1 x ThermoPol buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... 2.5 μL 10 mM MnCl2 and 2 μL Lambda Protein Phosphatase (NEB). The dephosphorylation reaction was allowed to occur at 30 °C overnight ...
-
bioRxiv - Immunology 2023Quote: ... 2 μL of T4 RNA Ligase (10 000 U/mL, NEB, M0204S), and 10 μL of PEG 8000 50% (NEB ...
-
Human immunodeficiency virus-1 induces and targets host genomic R-loops for viral genome integrationbioRxiv - Molecular Biology 2024Quote: ... gDNA (1.2 μg) was treated with 2 U RNase H (NEB, M2097) per µg of gDNA for 4 h at 37°C ...
-
bioRxiv - Bioengineering 2024Quote: ... A mastermix containing 2 mmol/L of each dNTP (NEB, Ipswich, MA), 4.5 µg of random hexamers (ThermoFisher ...
-
bioRxiv - Biochemistry 2024Quote: ... RNA was ligated using T4 RNA ligase 2 (M0242, New England Biolabs) to a preadenylated linker and purified with ROTI Aqua P/C/I for RNA extraction and precipitated with NaOAc ...
-
bioRxiv - Cancer Biology 2024Quote: ... Nucleosomes labeling the following reaction was used: NEBuffer™ 2 (NEB B7202), inhibitors (as detailed above ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µl of 100µM DTT and 1 µl of NudC (M0607S, NEB), then incubated for 30 min at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reverse transcription was initiated by adding 4 μl of 5× ProtoScript II Buffer (New England Biolabs), 2 μl of 0.1 M DTT ...
-
bioRxiv - Microbiology 2019Quote: ... and 4 μL was ligated at 16°C overnight with the T4 DNA ligase (NEB M0202S). After transformation into chemically-competent Top10 E ...
-
bioRxiv - Biophysics 2020Quote: ... the 5’ end of the 4 kb transcript was biotin-labeled using Vaccinia Capping System (NEB) and 3-biotin-GTP (NEB ...
-
bioRxiv - Biophysics 2021Quote: ... Primers were designed for the replacement of each of the 4 loops using Q5 polymerase (NEB) PCR reaction and a KLD enzyme mix (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... after ligation overnight at 4°C with the T4 DNA ligase (New England Biolabs, Evry, France).The sequences of the cloned fragments in the resulting plasmids pYES2::MlpCSP1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4 mM DTT) supplemented with 200 μM cold SAM (S- adenosyl methionine) (NEB; for immunoblotting) or 1 µCi 3H-labelled SAM (PerkinElmer ...
-
bioRxiv - Genetics 2022Quote: ... Donor 4) were combined in a single ligation reaction using T4 DNA Ligase (New England Biolabs) according to the manufacturer’s instructions and incubated overnight at 16°C ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were collected and incubated with 4 μM SNAP-Cell TMR-Star (New England Biolabs S9105) or SNAP-SiR647 (New England Biolabs S9102 ...
-
bioRxiv - Molecular Biology 2020Quote: ... the extension enzyme was replaced with 4 units of Bst 2.0 Warmstart DNA Polymerase (NEB, Cat.No.M0538). Correspondingly ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reverse transcription was initiated by adding 4 μl of 5X ProtoScript II Buffer (New England Biolabs), 2 μl of 0.1 M DTT ...
-
bioRxiv - Molecular Biology 2020Quote: ... an end-repair mastermix was made by combining 4 μl T4 DNA Ligase Reaction Buffer (NEB), 0.5 μl dNTP (10mM ...
-
bioRxiv - Biochemistry 2019Quote: ... 4°C) and the supernatant was added to 24 mL of amylose resin (NEB, Ipswich MA) pre-equilibrated with buffer C and nutated for 2 hr at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... After overnight incubation at 4°C in PBS-Perm with rabbit anti-GFP (1:1000, Biolabs) and mouse anti-MAP2 (1:2000 ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 ul of diluted DNA were used for McrBC digestion (NEB, 4 h at 37 °C) or mock digestion (the same volume of H2O instead of McrBC enzyme was added with all other components the same in the reaction ...
-
bioRxiv - Plant Biology 2023Quote: ... 4 pmol of double-stranded DNA was labeled with 1 unit of Klenow fragment polymerase (NEB) and 8 pmol Cy5-dCTP (Cytiva ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3-4 μg of sperm gDNA was dephosphorylated with 10 μl of rSAP (NEB, no. M0371S) and 16 μl of 10× rCutSmart buffer (NEB ...
-
bioRxiv - Genomics 2023Quote: ... 20 µg of total RNA was then treated with 4 units of DNAse I (NEB, #M0303S) for 1 h at 37°C ...
-
bioRxiv - Bioengineering 2023Quote: ... The 4 targeted CDRs were amplified by error-prone PCR using Taq polymerase (New England Biolabs), 1× Taq buffer (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 % cDNA product was used to perform semiquantitative PCR using 50 % Taq MM (New England Biolabs) and 0.5 µM of the forward (GAACCAGGAGTTAAGAACACG ...
-
bioRxiv - Molecular Biology 2023Quote: ... for which the completed ligation reaction was treated with 4 µL RecJf (New England Biolabs, M0264L) and 3 µL 5ʹ Deadenylase (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... Charles Gersbach) was PCR amplified (primers in Extended Data Table 4) and cloned into KpnI(NEB)-digested pLV-hUbC-dSpCas9-2xVP64-T2A-BSD via blunt-end ligation cloning (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Oligos were 5’-end radiolabeled at a final concentration of 4 μM with T4 PNK (NEB) and γ-32P-ATP after incubation for one hour at 37°C followed by enzyme inactivation at 72°C for 10 minutes ...
-
bioRxiv - Genetics 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs Set 4) (NEB, E6446S) as index primers ...
-
bioRxiv - Genomics 2024Quote: ... 4 μg of the barcoded plasmid library was linearized by digestion with NruI-HF (NEB #R3192) at 37°C for 16 hours ...