Labshake search
Citations for New England Biolabs :
851 - 900 of 7105 citations for 7 Boc 3 chloro 5 6 7 8 tetrahydroimidazo 1 2 a pyrazine 2 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2021Quote: ... and A-tailed using Klenow 3’-5’exo-enzyme (NEB, Cat. No. M0212). Illumina sequencing library adapters were subsequently ligated to DNA ends ...
-
bioRxiv - Genomics 2023Quote: ... and A-tailed with Klenow Fragment (3’-to-5’ exo-, New Englands Biolabs) following manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... which were then degraded by the 5’-3’ ssDNA exonuclease RecJ (NEB, M0264S). After rRNA reduction using the riboPOOL rRNA depletion kit (siTOOLs Biotech ...
-
bioRxiv - Molecular Biology 2020Quote: ... 200 ng of PCR product of RFLP_region 1 and RFLP_region 2 were digested with PstI (New England Biolabs) and VspI (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2019Quote: ... at 30°C for 1 hour in a total volume of 50μl PMP phosphatase buffer (50 mM HEPES pH 7.5, 100 mM NaCl, 2 mM DTT, 0.01% Brij 35, 1 mM MnCl2; New England Biolabs).
-
bioRxiv - Biochemistry 2020Quote: ... by incubating the cells with 2 μM ATTO594-Coenzyme A and 1 μM phosphopantetheine transferase (New England Biolabs) in Ham’s F12 medium without FBS at ~25°C for 20 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... A 32P radiolabelled Y’ PCR fragment (oligo sequences in Supplementary Table 1) or 2-log ladder (NEB N3200L) was added at 106 counts/ml of Y’ and 104 counts/ml of 2-log ladder and hybridized overnight ...
-
bioRxiv - Microbiology 2022Quote: ... region between MCS-1/MCS-2 and linearized pETDuet plasmid were ligated using the Gibson Assembly® (NEB) to generate the pETDuet pe15/ppe20 plasmid ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and assembled into the backbone vector at a 2:1 molar ratio via Golden Gate Assembly81 (NEB #R3733). The assembly mix was then transformed into electrocompetent DH10B E ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 µL of each reaction was combined with 2 µL of 6X Purple Gel Loading Dye (NEB B7024S) and 11 µL H2O and run on a 1.2% agarose gel containing 1X GelGreen Nucleic Acid Stain (Biotium 41005 ...
-
bioRxiv - Microbiology 2022Quote: ... 1 μl of methylation-sensitive restriction enzyme DpnI and 2 μl CutSmart® buffer (both from NEB inc.) were added to the assembled reaction and incubated at 37 °C for 30 min ...
-
bioRxiv - Cancer Biology 2023Quote: We then set up the digestion reaction (1.5 μg of pX459, 2 μL of 10X NEBuffer 2.1, 1 μL of BbsI (NEB), and added H2O to a final volume of 20 μL) ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 mM NaCl, 2 mM EDTA, 1% NP40, 0.1%SDS, 0.5 mM DTT, 40 U RNase inhibitor [New England Biolabs, cat#M0314L] ...
-
bioRxiv - Bioengineering 2024Quote: ... DNA fragments encoding CDRs 1 and 2 were digested overnight with BsaI-HFv2 and BbsI-HFv2 respectively (NEB). Reactions were cleaned up with Macherey Nagel Gel cleanup columns ...
-
bioRxiv - Genomics 2021Quote: ... 5 μl of 100 ng/μl cDNA diluted from the previous step was combined with 2 μl block mix and 2 μl nuclease free water (NEB, catalog no. AM9937), then the cDNA-block oligo mix was incubated on a thermocycler under the following condition to allow block oligo mix to bind to 5’ and 3’ end of the cDNA molecule ...
-
bioRxiv - Cancer Biology 2020Quote: ... 3’ A-overhang was then added to the ends of blunted DNA fragments with Klenow Fragment (3’-5’ exo-) (NEB M0212L) and the PCR clean-up was performed using QiaQuick kit ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µg DNA was digested with 3 µl Hind III (Fisher, FD0504), 3 µl EcoRI (Fisher, FD0274), and 3 µl Bam HI (Fisher, FD0054) +/-5 µl RNase H (NEB, M0297) in RNase H buffer (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: Synthetic RNA fragments bearing a 3′P were subjected to 5′ phosphorylation with T4 PNK 3′ minus (NEB, cat n° M0236S), according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Klenow-mediated addition of an adenine to the 3’ end of the DNA fragments was performed using the Klenow fragment (3’→5’ exo-) kit (NEB, M0212L) by combining the 32 μl sample with 5 μl 10X Klenow Buffer NEB 2 ...
-
bioRxiv - Microbiology 2021Quote: ... and Down primer sets were used in individual PCR reactions alongside the common primers 5’ GGTAACTGTCAGACCAAGTTTACTC 3’ (Up) or 5’ GAGTAAACTTG-GTCTGACAGTTACC 3’ (Down) using Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs, M0494). Primers were designed as described in https://github.com/a5russell/Defective_Library_Mendes_Russell ...
-
bioRxiv - Developmental Biology 2023Quote: ... the pre- microRNA sequence of mir-51 was amplified from genomic DNA using PCR and primers 5’-cggcatcgacgacgacgacggtccgaaaagtccgtctacc-3’ and 3’- cagttggaattctacgaatgaactgtattgctgctgggc-5’ and the vector containing the sequence of rgef-1p and unc-54 3’UTR amplified from plasmid rgef-1p::aak-2::unc-54 3’UTR using PCR and primers 5’-cattcgtagaattccaactgagc-3’ and 3’-cgtcgtcgtcgtcgatgc-5’ were used to generate rgef-1p::mir-51::unc-54 3’UTR by using Gibson assembly (NEB E2611).
-
bioRxiv - Molecular Biology 2019Quote: ... The 5’-hydroxyl standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with calf intestinal phosphatase (NEB). The cap 0 standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with Vaccinia virus capping enzyme (VCE ...
-
bioRxiv - Genetics 2021Quote: ... two complementary oligos containing the guide sequence and a BbsI recognition site (Oligo F: 5’CACCGNNNNNNNNNN….3’ and Oligo R: 5’AAACNNNNNNNNNN…..C3’) were annealed and cloned into the BbsI (NEB) digested target plasmid.
-
bioRxiv - Physiology 2021Quote: ... samples were resuspended in RNAse-free water and ligated to a 5’-adenylated DNA adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′ (M0373, New England Biolabs), for 3 hours at room temperature ...
-
bioRxiv - Biochemistry 2022Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using 5′ DNA adenylation kit at the 5′ end (NEB). To reduce a ligation bias ...
-
bioRxiv - Microbiology 2022Quote: ... The 5’-RNA adapter (5’-CCUUGGCACCCGAGAAUUCCA-3’) was ligated to the 5’ end of the RNA using T4 RNA ligase I (NEB). RNA was purified as above by binding to streptavidin beads ...
-
bioRxiv - Molecular Biology 2023Quote: ... Non-IRES mRNAs were capped the 3’-O-Me-m7G(5’)ppp(5’)G anti-reverse cap analog (NEB # S1411L). IRES mRNAs were capped with the A(5’)ppp(5’)G cap analog (NEB # S1406L) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using 5′ DNA adenylation kit at the 5′ end (NEB). To reduce a ligation bias ...
-
bioRxiv - Biochemistry 2023Quote: ... Desalted peptides were dissolved in 1 ml 1 × CutSmart buffer (pH 8, New England BioLabs) and incubated with 50 units of alkaline phosphatase (calf intestinal ...
-
bioRxiv - Plant Biology 2021Quote: ... 5 and 6 and then assembled into pASW vector by NEBuilder Hifi DNA Assembly kit (NEB).
-
bioRxiv - Immunology 2023Quote: ... We then used a 2:1 insert to vector ratio in a 1 hour Hifi assembly reaction using NEBuilder HiFi DNA Assembly kit (NEB, Cat. No. E2621). The Hifi assembly products were Ampure bead purified and eluted into 20 µL of H2O ...
-
bioRxiv - Microbiology 2023Quote: ... We then used a 2:1 insert to vector ratio in a 1 hour HiFi assembly reaction using NEBuilder HiFi DNA Assembly kit (NEB, Cat. No. E2621). HiFi assembly products were Ampure bead purified and eluted into 20uL of H2O for higher electroporation efficiency.
-
bioRxiv - Molecular Biology 2021Quote: ... 5 µL of linker ligation mixture was added (38% PEG-8000, 1x NEB T4 ligase buffer, 2 µM oBZ407_preA preadenylated linker, 100 units NEB T4 RNA ligase 2, truncated) and they were further incubated at 37 °C for 3 hrs ...
-
bioRxiv - Molecular Biology 2020Quote: ... and then ligated to pre-annealed double-stranded adaptors that contain single dT overhangs and a unique molecular identifier (UMI) consisting of a randomized 8-base sequence containing a 3-base specific barcode by T4 DNA ligase (NEB) overnight at 15 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 3’ adenine overhangs were added to the blunt-end DNA fragments by Klenow Fragment (3’-5’ exo; NEB; Cat. No. M0212L). The DNA fragments were then ligated with diversity-increased custom barcodes (Shi et al. ...
-
bioRxiv - Microbiology 2022Quote: ... and we amplified mEmerald including vector sequence but omitting the mitochondrial targeting sequence from the mEmerald-Mito-7 plasmid using primers mEmeraldVector forward (5’ TGGATCCATGGGGGATCCACCGGTCGCC 3’) and mEmeraldVector reverse (5’ ACACCGACATGCTAGCGGATCTGACGGTTCAC 3’) and combined the fragments using a HiFi assembly kit (New England Biolabs, Ipswich, MA) to create a plasmid expressing CHMP4B-mEmerald ...
-
bioRxiv - Biochemistry 2023Quote: ... primers “frq segment 2F” (5’-GTGAGTTGGAGGCAACGCTC-3’) and “frq segment 2R” (5’-GTCCATATTCTCGGATGGTA-3’ were used for PCRs in combination with pCB05 digested with XhoI (NEB, Catalog # R0146S) to NruI (NEB ...
-
bioRxiv - Genetics 2023Quote: ... PCR-derived DNA fragments were generated by pairing oWS1359 (5°-TATGATTCCGATGAAGAAGAACAAGGTGGCGAAGGTGTACAATGT-iTriMix20-iTriMix20-iTriMix20-TGATTTTCTTGATAAAAAAAGATC-3°) and oWS1308 (5°-CAGCATATAATCCCTGCTTTA-3°) and pWS1728 template using a high-fidelity Q5 polymerase (New England Biolabs, Ipswich, MA). The PCR products were purified (Omega E.Z.N.A Cycle Pure kit ...
-
bioRxiv - Microbiology 2020Quote: ... then quenched with 2 μL 6X purple loading dye (NEB) at RT ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 µL of 10x uracil DNA glycosylase buffer (NEB M0280S), 2.5 µL RNase A (M0280S ...
-
bioRxiv - Molecular Biology 2021Quote: ... 100 units of 2’-O-Me-transferase (New England Biolabs) and 25 units RNasin Plus RNase inhibitor (Promega) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 200 U/uL of T4 RNA Ligase 2 (NEB M0351S), 1X T4 RNA Ligase Reaction Buffer (NEB B0216L) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2 uL of 10X T4 RNA ligation buffer (NEB B0216L), 2 uL of 10mM ATP ...
-
bioRxiv - Developmental Biology 2020Quote: ... a mix containing 2 μl of RNAse H (NEB, #M0297S), 1 μl of E ...
-
bioRxiv - Genomics 2020Quote: ... 2 μL of NEB buffer 3.1(1X, New England Biolabs) and 1 μL of each DNA barcode B and ligation linker mix (B1-B50 ...
-
bioRxiv - Microbiology 2022Quote: ... PEG 8000 (17.5% final) and T4 RNA ligase 2 (NEB) in 1x T4 RNA ligase buffer at 25°C for 1 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 0.5 units/µl T4 RNA Ligase 2 (NEB, M0239S), with the enzyme added after the other components had been mixed and incubated at 23°C for 5 min ...
-
bioRxiv - Genomics 2020Quote: ... 2 μL of NEB DNA Quick Ligase (New England Biolabs) and 3 μL of Illumina Indexed adapter were added to the beads and incubated for 15 minutes at room temperature ...
-
bioRxiv - Genomics 2019Quote: ... 12.5 µL NEBNext High-Fidelity 2× PCR Master Mix (NEB) were added and samples were PCR-amplified (72 °C 5 min ...
-
bioRxiv - Genomics 2020Quote: ... 12.5 μL NEBNext High-Fidelity 2× PCR Master Mix (NEB) were added and samples were PCR-amplified (72 °C 5 min ...