Labshake search
Citations for New England Biolabs :
851 - 900 of 3826 citations for 7 11 Dimethyldodeca 4 6 10 trien 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... the first round of PCR consisted of 7 cycles of the following program using Q5 High-Fidelity DNA Polymerase (New England Biolabs). Step1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were generated by 7-9 rounds of PCR amplification using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L), purified using SPRIselect reagent kit (Beckman Coulter ...
-
bioRxiv - Neuroscience 2023Quote: ... GDNA was isolated from 7 dpf efemp1+/+ or efemp12C-Cas9 zebrafish eyes using a Monarch Genomic DNA Purification Kit (T3010S; NEB) and quantified using a Nanodrop 1000 (Thermo Fisher Scientific) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Ligation was performed on a 7-fold dilution of HindIII-digested chromatin using 100 units of Quick T4 DNA ligase (New England Biolabs) at 16°C for 16 hours ...
-
bioRxiv - Genomics 2023Quote: ... all final Illumina compatible ERα STARRseq and ERα-focused STARR-seq capture libraries were prepared by PCR amplification (7 cycles) with NEBNext universal and single indexing primers (NEB), and were sequenced on Illumina NovaSeq 6000 (150bp Paired-End).
-
bioRxiv - Immunology 2023Quote: ... and subsequently modified by the addition of a 7-methylguanosine cap with the Vaccinia Capping System (New England Biolabs [NEB]) using the NEB Capping protocol (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: Assessment of the integration status of the HPV-positive HNSCC cell lines was characterized for each cell line and digested with 7 µg of total genomic DNA at 37°C overnight (20 hours) with either EcoRV (New England BioLabs) or Bam HI ...
-
bioRxiv - Neuroscience 2024Quote: Total RYR1 transcripts were amplified as 7 overlapping PCR products.38 They were sequenced after fragmentation and library preparation using NEBNEXT NGS workflow (New England Biolabs) according to manufacturer recommendation ...
-
bioRxiv - Immunology 2023Quote: ... and subsequently modified by the addition of a 7-methylguanosine cap with the Vaccinia Capping System (New England Biolabs [NEB]) using the NEB Capping protocol (NEB ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Custom P1 adapters containing unique 7-bp barcodes (Hohenlohe, Bassham, Currey, & Cresko, 2012) were ligated to each individual sample with T4 ligase (New England Biolabs). The DNA from all uniquely barcoded individuals in a library was pooled at equimolar concentration ...
-
bioRxiv - Genomics 2019Quote: ... DNA was digested by adding 10 µL NlaIII (10 U/µL, NEB) and incubated for 3½ h at 37 °C with shaking at 1200 rpm ...
-
bioRxiv - Cancer Biology 2020Quote: ... The ligation reaction (10 μL) consisted of 10 units of BbsI (NEB), 600 units of T4 DNA ligase (NEB) ...
-
bioRxiv - Plant Biology 2020Quote: ... Library preparation began with digestion of 100 ng cleaned genomic DNA at 37°C for 4 h in 15 μL containing 4 U FspEI (NEB), 1X CutSmart Buffer (NEB) ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was fragmented via ultrasound (4 pulses a 30 sec, 4 °C) and subsequently treated with T4 Polynucleotide Kinase (NEB). Half of the samples were then treated with terminator exonuclease (TEX ...
-
bioRxiv - Molecular Biology 2023Quote: ... pooled total RNA was fragmented with ultrasound (4 pulses of each 30 sec at 4°C) and then treated with T4 Polynucleotide kinase (NEB). The RNA of each sample was then divided in half ...
-
bioRxiv - Microbiology 2024Quote: ... the total RNA samples were fragmented using ultrasound (4 pulses of 30 sec at 4°C) followed by a treatment with T4 Polynucleotide Kinase (New England Biolabs). The RNA samples were then split into two halves and one half was subjected to Terminator Exonuclease treatment (+TEX) ...
-
bioRxiv - Biophysics 2023Quote: ... After 4 hours of incubation (required for transcription) RNA was directly treated with 4 units of DNase I (NEB, M0303S) to remove linear or circular DNA used as a template for transcription (see details in Supplementary Methods) ...
-
bioRxiv - Molecular Biology 2021Quote: ... the samples were mixed with 6× SDS-free Purple Loading Dye (New England Biolabs) supplemented with SYBR Gold and the cleavage products were resolved by native 1.2% agarose gel electrophoresis ...
-
bioRxiv - Biochemistry 2020Quote: ... 6 units of T4 DNA polymerase and 400 units of T4 DNA ligase (NEB) were then added and the reaction was incubated at 12°C for 1 hour to allow second strand synthesis ...
-
bioRxiv - Genomics 2021Quote: ... The decapped RNA was Recapped with 6 μL Vaccinia Capping Enzyme (VCE) (NEB, #M2080) in 1X VCE reaction buffer (50 mM Tris HCl ...
-
bioRxiv - Plant Biology 2019Quote: ... 6 μg of DNA was digested with restriction enzyme EcoRI (New England Biolabs, USA). Digested DNA was separated on 0.8% agarose gel and blotted onto Hybond-N+ nylonmembrane (Amersham Pharmacia Biotech ...
-
bioRxiv - Molecular Biology 2022Quote: ... the samples were mixed with 6× SDS-free Purple Loading Dye (New England Biolabs) supplemented with SYBR Gold ...
-
bioRxiv - Molecular Biology 2023Quote: ... A total of 6-12 µg of genomic DNA was dephosphorylated with rSAP (NEB), followed by AMPure XP beads purification ...
-
bioRxiv - Biophysics 2023Quote: ... The samples were mixed with 6 × purple loading dye without sodium dodecyl sulfate (NEB) and with 10 × TBE to make a 1 × solution ...
-
bioRxiv - Bioengineering 2022Quote: One μL of amplicons from colony PCR is mixed with 1 μL of Gel Loading Dye (6x; NEB) and 4 μL of nuclease-free water in each well on the 1.2% agarose gel (Sigma ...
-
bioRxiv - Genetics 2019Quote: ... the product was digested for one hour at 37°C using 40 U EcoO109I (New England Biolabs, USA), 5 µL accompanying buffer solution ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR on extracted RNA was performed using the Luna One-Step RT-qPCR Kit (New England Biolabs). The samples were analyzed using a Lightcycler 480 instrument (Roche ...
-
bioRxiv - Cell Biology 2021Quote: ... One of each pair was treated with 0.5 μl of calf intestinal phosphatase (CIP) (New England Biolabs #M0290) before the pair were incubated at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2022Quote: ... coli and ligated to one end using Golden Gate assembly with BsmBI and T4 DNA ligase (NEB, Vazyme). All oligos and the corresponding templates used in the cloning for these experiments are outlined in Table S6 ...
-
bioRxiv - Microbiology 2021Quote: ... Reverse transcription and qRT-PCR analysis was performed by Luna universal one- step qRT-PCR kit (NEB # E3005L) with primers list in Table 9.
-
bioRxiv - Microbiology 2020Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-F ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Immunology 2021Quote: ... The purified Cxcl1 promoter fragment was equally split into two groups: one treated with M.SssI (New England Biolabs) and the other without M.SssI (“mock” ...
-
bioRxiv - Immunology 2022Quote: ... The qPCR was performed using the NEB Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with cycling conditions of 10 min at 55°C for reverse transcription ...
-
bioRxiv - Cell Biology 2019Quote: ... One thousand three hundred micrograms of DNA-free RNA were used for cDNA synthesis with random hexamers (NEB) using SuperScript II (ThermoFisher ...
-
bioRxiv - Microbiology 2019Quote: A total reaction volume of 25μL consisting of 12.5μL of One Taq® 2X Master Mix (New England Biolabs), 0.2 μL of DNA template (< 1000 ng) ...
-
bioRxiv - Bioengineering 2020Quote: ... The RT-PCR detection was conducted by using the Luna Universal One-Step RT-qPCR kit from NEB and following its protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... Regions of interest were amplified by PCR using a One-Taq Hot Start DNA-polymerase (New England Biolabs) with standard buffer and 3% DMSO and the following primers targeting exon2 (L ...
-
bioRxiv - Microbiology 2022Quote: ... Detection of selected targets was performed with Luna® Universal One-Step RT-qPCR (New England BioLabs Inc.) according to manufacturers protocol using specific primers ...
-
bioRxiv - Microbiology 2022Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-Forward ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-Reverse ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Molecular Biology 2022Quote: ... This was followed by one round poly(A) purification using oligo d(T) magnetic beads (New England Biolabs). 1.5-2 µg of mRNA was fragmented to 100-150 nts using RNA Fragmentation Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: Plasmid DNA containing one copy of the SIV gene was linearized using EcoR1 (New England Biolabs, Ipswich, MA) following their restriction digest protocol (New England BioLabs ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA synthesis and qRT-PCR were performed simultaneously using the Luna Universal One-Step RT-qPCR kit (NEB) with the Quantstudio 7 Flex (Life Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNA synthesis and RT-qPCR was carried out using Luna® Universal One-Step RT-qPCR Kit (NEB) according to the manufacturer’s instructions with 100 ng of mRNA ...
-
bioRxiv - Bioengineering 2023Quote: ... cloning was achieved via one-pot restriction-ligation reactions with type IIS restriction enzymes (NEB or Thermo Scientific) and T4 DNA ligase (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... RNA expression levels were quantified using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs #E3005L) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... one well of cells was sacrificed for direct lysis in 2% SDS blue loading buffer (New England Biolabs) and protein analysis of tau and β-III-tubulin (Sigma T-8660 ...
-
bioRxiv - Microbiology 2023Quote: PCR was carried out using NEB Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs, E3006) or Taqman Fast Universal PCR master mix (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2024Quote: ... one cell stage zebrafish embryos were injected with 50 nM EnGen® Lba Cas12a (Cpf1) (New England Biolabs) and each gRNA at a final concentration of 2 nM ...
-
bioRxiv - Molecular Biology 2024Quote: ... 100 ng of DNA template in 25 µl of 1x One Taq Standard Buffer (Biolabs, Ipswich, MA, USA), 0.2 mM dNTPs ...