Labshake search
Citations for New England Biolabs :
851 - 900 of 2328 citations for 6 CHLORO 3 METHYLPYRIDO 3 4 D PYRIMIDIN 4 3H ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... The 3’ ends of the VSV G and GP64 ORFs were PCR-amplified (using Taq polymerase, NEB) from DNA isolated from each fly line ...
-
bioRxiv - Genomics 2024Quote: ... along with a 4.8uL 3:2 master mix of T4 ligase buffer:T4 ligase (New England Biosciences, NEB) and 9.4uL of nuclei buffer with BSA (NBB ...
-
bioRxiv - Cell Biology 2020Quote: ... the pHRRA1-GFP (pKS85) (Table 4) plasmid was PCR-amplified with Phusion HF Polymerase (NEB), using primers designed using the QuikChange Primer Design tool (Agilent) ...
-
bioRxiv - Immunology 2022Quote: The I53-50A and I53-50B.4.PT1 proteins26 were expressed in Lemo21(DE3) (NEB) in LB (10 g Tryptone ...
-
bioRxiv - Microbiology 2019Quote: ... then 100 μL of 4 mg/mL p-nitrophenyl phosphate (New England Biolabs, MA, USA) was added and the mixture was vortexed again ...
-
bioRxiv - Bioengineering 2019Quote: ... 5 μL of 10 × GlycoBuffer 4 (supplied by NEB, 500 mM Sodium Phosphate, pH 4.5), and 1 μL of α1-2,3,6 Mannosidase.
-
bioRxiv - Bioengineering 2020Quote: The following components comprised the RT-LAMP assay: 4 mM of MgSO4 (New England Biolabs), 1× final concentration of the isothermal amplification buffer (New England Biolabs) ...
-
bioRxiv - Biochemistry 2021Quote: ... for 1 hr at 37 °C and Proteinase K (4 U; P8107S, NEB, Ipswich, MA) for another 2 hr at 55 °C ...
-
bioRxiv - Genomics 2021Quote: ... the following were added into each reaction tube: 0.5 μL of 10x buffer 4 (NEB), 0.5 μL of 1 mg/mLbovine serum albumin solution (NEB) ...
-
bioRxiv - Immunology 2020Quote: The I53-50A and I53-50B.4.PT1 proteins were expressed in Lemo21(DE3) (NEB) in LB (10 g Tryptone ...
-
bioRxiv - Cancer Biology 2021Quote: ... the PCR product was incubated for 4 hours with 2uL DpnI (NEB, Cat. No R0176), at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... The second strand was synthesized with 4 U of T7 DNA polymerase (New England BioLabs) and purified with HighPrep PCR beads (MagBio) ...
-
bioRxiv - Molecular Biology 2020Quote: ... each with 1 μg of gDNA first being digested with 4 U of MmeI (NEB) for 2 hours at 37 °C ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 5 μl of the resulting amplicon were diluted 1:4 in 1x buffer 2 (NEB), followed by denaturation and re-annealing in a nexus GSX1 Mastercycler (Eppendorf ...
-
Structure and mechanism of a Type III CRISPR defence DNA nuclease activated by cyclic oligoadenylatebioRxiv - Biochemistry 2019Quote: ... After adding 4 μl 6x DNA loading dye (New England BioLabs, Ipswich, MA, United States), 10 μl sample was analysed by 0.7% native agarose gel electrophoresis ...
-
bioRxiv - Developmental Biology 2021Quote: ... and the fragments were ligated over night at 4°C with T4 DNA Ligase (NEB) and heat shock transformed into DH5α competent E ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 μL 10× Poly(A) Polymerase Reaction Buffer and 1 μL Poly(A) Polymerase (NEB) for poly(A ...
-
bioRxiv - Microbiology 2022Quote: ... PCR master mix reagents (see Figure 4): Taq polymerase and 10X Reaction Buffer (NEB M0273S), nucleotide mix containing 10 mM dTTP ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 ug from each cell line was digested with 25 units EcoRI (New England Biolabs) in 100 ul total volume ...
-
bioRxiv - Molecular Biology 2022Quote: ... 250ng of genomic DNA was digested with the 4-base cutter MnlI (NEB, Ipswich, MA), overnight at 37°C according to manufacturer’s recommendations ...
-
bioRxiv - Genomics 2023Quote: ... and ligated for 4 hours using 2000 U T4 DNA ligase (New England Biolabs, M0202L). Subsequently ...
-
bioRxiv - Cancer Biology 2023Quote: ... A negative control treated for 4 hours at 37 °C with RNaseH1 (New England Biolabs) was included for each condition ...
-
Essential roles of the ANKRD31-REC114 interaction in meiotic recombination and mouse spermatogenesisbioRxiv - Genetics 2023Quote: ... Plugs were rinsed with TE and then washed with 1 ml NEB buffer 4 (NEB) 3 × 15min ...
-
bioRxiv - Bioengineering 2023Quote: ... Frozen cell pellets were resuspended in 4 mL of IMAC buffer (NEB, Ipswich, MA, USA) on ice and dispersed using an ultrasonic disruptor (Sonics ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The purified PCR product was digested with XhoI and NheI restriction enzymes for 3h in CutSmart buffer (NEB). One hour before the end of the reaction ...
-
bioRxiv - Genomics 2021Quote: ... One μL APOBEC3A (NEB #E7120S) was added directly to the reaction with 10 μL of 10x APOBEC3A reaction buffer and 1 μL BSA (10 mg/mL) ...
-
bioRxiv - Cell Biology 2023Quote: ... and one in-solution (NEB) DNase digestions were performed ...
-
bioRxiv - Genomics 2021Quote: ... the purified products are treated with Klenow fragment (3’ → 5’ exo-) (Cat. No. M0212L; NEB; use 1 uL) and Taq DNA polymerase (Cat ...
-
bioRxiv - Evolutionary Biology 2021Quote: 3’ dephosphorylation was performed by incubating fragments with 10 U/uL T4 Polynucleotide Kinase (New England Biolabs M0201S) in the supplied buffer (NEB B0201S ...
-
bioRxiv - Neuroscience 2021Quote: NFIB 3’ UTR and 5’ UTR HP forming regions were in vitro transcribed using T7 transcriptase (NEB, E2040) and purified with Trizol extraction (described in RT-qPCR paragraph) ...
-
bioRxiv - Genomics 2020Quote: ... before and in between the following procedures: (1) 3′ adapter ligation with T4 RNA Ligase 1 (NEB, M0204L), (2 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5’-monophosphate standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with Apyrase (NEB). The 5’-hydroxyl standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with calf intestinal phosphatase (NEB) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 mM of each of the other three dNTPs and 5 U Klenow fragment (3’—>5’ exo-, NEB) in the corresponding buffer ...
-
bioRxiv - Molecular Biology 2019Quote: ... About 2-3 μg of source DNA plasmid (<10 kb) was added with NEBuffer 3.1 (NEB, cat# B7203S), DEPC ddH2O in a volume of 30 μl and incubated at 37 °C for >2 hour (h) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... This fragment was generated by a standard 3-step PCR protocol using Phusion DNA polymerase (New England Biolabs) and then cloned into the XbaI and HindIII sites of pEX18A (Prentki and Krisch ...
-
bioRxiv - Molecular Biology 2019Quote: ... Fragmented RNA was then subjected to RNA 3’ linker ligation using T4 RNA Ligase I (New England Biolabs) and reverse transcription using a primer complementary to the linker sequence and SuperScript III (ThermoFisher ...
-
bioRxiv - Genomics 2020Quote: ... RNA was resuspended in 5 μl of water and the 3′ ends dephosphorylated with PNK (New England BioLabs) in MES buffer (100 mM MES-NaOH ...
-
bioRxiv - Bioengineering 2020Quote: ... and the 3’ extension were ligated together into the digested vector using Quick Ligase or T4 Ligase (NEB) to generate the complete pegRNA plasmid ...
-
bioRxiv - Neuroscience 2019Quote: ... Ten microliters of PCR products were digested with Nsi1 (3 hours with 5 units of Nsi1 enzyme (NEB)) and then ...
-
bioRxiv - Synthetic Biology 2021Quote: ... qPCR was carried out using the primers in Supplementary Table 3 and Luna Universal qPCR Master Mix (NEB) in a BioRad iCycler in technical triplicates for each biological replicate ...
-
bioRxiv - Immunology 2021Quote: ... we modified the plasmid using primers EpMap_1 and EpMap_2 along with ssODN EpMap1_ssODN (Extended Data Table 3) using the NEBuilder Mastermix (NEB, E2621S) following the manufacturer’s instructions in order to create hairpin-free overlap regions that could be used for homology-based library cloning ...
-
bioRxiv - Microbiology 2022Quote: ... 2.5µL of 10µM MBTUni-12 primer + 2.5µL of 10µM MBTUni-13 primer (5’-ACGCGTGATCAGTAGAAACAAGG-3’) + 10µL 5x HF Phusion Buffer + 1µL 10mM dNTPs mix (NEB #N0447S) + 0.5µL Phusion Polymerase + 28.5µL of Nuclease-free water (Ambion ...
-
bioRxiv - Molecular Biology 2020Quote: ... was added at 3’end of RA5) was ligated to RNA using T4 RNA ligase (New England Biolabs) at 25°C for 6 hr and 22°C for 6 hr ...
-
bioRxiv - Molecular Biology 2019Quote: ... HIS3_hp_For 5′ AAAAGCTTGACCGAGAGCAA and HIS3_hp_Rev 5′ GCGTATTACAAATGAAACCAAGATTCA) and initially cloned into pRS405 (3) between HindIII and XhoI (NEB). A DNA segment containing the GAL1 promoter ...
-
bioRxiv - Microbiology 2019Quote: The DNA oligo i116 that served as a 3’ adapter was adenylated using 5’ DNA Adenylation Kit (NEB), purified by ethanol precipitation as above and diluted to 10 μM with nuclease-free water.
-
The absence of C-5 DNA methylation in Leishmania donovani allows DNA enrichment from complex samplesbioRxiv - Molecular Biology 2020Quote: ... and cloned between 300 bp of PCR amplified DNA fragments of the LdBPK_250018100.1 5’ and 3’ UTR using NEBuilder (NEB) inside pUC19 for construct amplification in E ...
-
bioRxiv - Molecular Biology 2021Quote: ... Promoters (Supplemental Figure 1, Supplemental Table 3) were amplified from genomic DNA using Q5 polymerase (New England Biolabs) and inserted between the enhancer and 24xMS2 sequences using restriction enzyme-mediated ligation ...
-
bioRxiv - Molecular Biology 2021Quote: ... Homology arms and exon 3 of the murine Akr1b3 locus were amplified with Q5 polymerase (New England Biolabs) using genomic DNA from mouse R1 ES cells (23) ...
-
bioRxiv - Immunology 2020Quote: ... 1 mM ATP and 3 units of T4 DNA ligase for 2 h at RT (all from NEB). Next ...
-
bioRxiv - Systems Biology 2021Quote: ... Adaptors for Illumina sequencing were added via PCR amplification using Nspacer_barseq_pHIMAR (Wetmore et al., 2015) and NEBNext Index 3 Primer for Illumina (New England Biolabs). Cycle conditions were 30 seconds 98°C followed by 4 cycles (15 seconds 98°C ...