Labshake search
Citations for New England Biolabs :
851 - 900 of 2067 citations for 5 Sulfosalicylaldehyde sodium salt since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 5 μL of 2X protein synthesis buffer (New England Biolabs, Beverly, MA), 0.25 μL of RNaseOUT RNAse inhibitor (Thermo-Fisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... The mixtures were mixed with 5 µl RNA dye (New England Biolabs) and separated by 12% TBE PAGE ...
-
bioRxiv - Cell Biology 2023Quote: ... Digested DNA was treated with Klenow Fragment (3’→5’ exo-) (NEB, M0212) in a final volume of 250 µL of 1x NEBNext dA-tailing reaction buffer (NEB) ...
-
bioRxiv - Biophysics 2023Quote: ... followed by 5’-end phosphorylation with T4 PNK (New England Biolabs, NEB) and simultaneous blunt ligation of the plasmid using T4 DNA ligase (NEB) ...
-
bioRxiv - Biophysics 2023Quote: ... followed by 5’-end phosphorylation with T4 PNK (New England Biolabs, NEB) and simultaneous blunt ligation of the plasmid using T4 DNA ligase (NEB) ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting 5’ biotinylated PCR products were digested with BsaI-HF (NEB) to generate four base-pair overhangs ...
-
bioRxiv - Cell Biology 2023Quote: ... and for A-tailing with Klenow Fragment (3’->5’ exo–) (NEB; M0212). A biotinylated primer (ENDseq-adaptor-1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... dinucleotide primers were 5’-labeled using T4 polynucleotide kinase (New England Biolabs) and added at 20 µM without pre-annealing to the template ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ phosphorylation of RNA fragments was achieved using T4 Polynucleotide Kinase (NEB) and Adenosine 5’-Triphosphate (ATP ...
-
bioRxiv - Genomics 2024Quote: ... After dATP tailing with Klenow fragment (3’ è 5’ exo-; NEB # M0212), we performed ligation with Illumina Dual Index UMI adaptors (NEB # E7395 ...
-
bioRxiv - Systems Biology 2024Quote: ... Each construct was transformed into standard 5-alpha competent bacteria (#C2987; NEB) grown overnight in in 500 ml of standard Luria Broth (LB ...
-
bioRxiv - Molecular Biology 2024Quote: ... Samples were then treated with 5 units of Antartic phosphatase (NEB M0289S) in a final volume of 50 µL for one hour at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... TdT reaction buffer (1.5 µl), CoCl2 (5 µl, 0.25 mM) (NEB #B0252), and filtered H2O (4.5 µl ...
-
bioRxiv - Genomics 2024Quote: Mix gently and add 5 ul of 20mg/ml proteinase K (NEB) solution to each tube and incubate for 3 hr at 45°C being careful there is no condensation.
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ triphosphates on the synthesis products were converted into 5’ monophosphates: samples were treated with recombinant shrimp alkaline phosphatase (NEB) (10 µl reaction in 1× NEB buffer 2.1, 37°C 30 min, 65°C 5 min), these reactions were made up to 15 µl including 0.5 µl 10× NEB 2.1 ...
-
bioRxiv - Cell Biology 2020Quote: 5′ end phosphorylation and radiolabeling (1x PNK buffer, 40 U T4 PNK (NEB), 40 μCi 32P-γATP ...
-
bioRxiv - Cell Biology 2020Quote: 5′ linker ligation (1x PNK buffer, 40 U T4 RNA ligase I (NEB), 80 U RNasIN ...
-
bioRxiv - Developmental Biology 2021Quote: ... 10 μg of nucleic acid was digested with 5 μL RNase H (NEB) at 37°C for 16 hours and 10 μg was mock digested without RNase H ...
-
bioRxiv - Molecular Biology 2021Quote: ... which was treated with 5 units of T7 endonuclease 1 (New England Biolabs) for 20 min at 37 °C and analyzed by 2% agarose gel electrophoresis ...
-
bioRxiv - Molecular Biology 2020Quote: ... except that 5 uL of Phusion Hot Start Flex 2X Master Mix (NEB) was used ...
-
bioRxiv - Genomics 2019Quote: ... The mixture was supplemented with 5 µL DNA polymerase (3 U/µL, NEB) and 6 µL Klenow (5 U/µL ...
-
bioRxiv - Molecular Biology 2021Quote: ... Eluted cDNA was amplified 5-cycles (NEBNext Ultra II Q5 master mix (NEB) with Illumina TruSeq PCR primers RP-1 and RPI-X ...
-
bioRxiv - Neuroscience 2019Quote: ... was first transformed into NEB 5-alpha competent cells (New England Biolabs #E2621S) and plated on LB plus ampicillin (60 µl/ml).
-
bioRxiv - Cell Biology 2019Quote: ... 5 µl was used for BglII digestion (NEB, 2 hours at 37°C) and the products were loaded on a 2% agarose gel to confirm the pAS insertion ...
-
bioRxiv - Genetics 2019Quote: ... and then treated with 5 units of T7 endonuclease 1 (New England Biolabs) for 30 min at 37°C and finally analyzed by 2% agarose gel electrophoresis.
-
bioRxiv - Immunology 2019Quote: ... followed by site-directed mutagenesis using the Q-5 kit (New England Biolabs) in order to generate point mutations into MIC1 (MIC1-T126A/T220A ...
-
bioRxiv - Molecular Biology 2021Quote: The 5’ RACE PCR product was digested using BamHI (New England Biolabs R0136) and EcoRV (New England Biolabs R3195 ...
-
bioRxiv - Genetics 2020Quote: ... 3 µl of dNTPs (2.5 mM each) and 5 U Klenow exo- (NEB) and incubating for 1 h at 30°C ...
-
bioRxiv - Biochemistry 2021Quote: 100 μl extension reactions were performed with Klenow Fragment (3’→5’ exo-) (NEB) (Figures 2B ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5 μg were digested overnight at 37°C with FspEI (NEB, R0662S), which recognizes CMC sites and creates a double-stranded DNA break on the 3’ side of the modified cytosine at N12/N16 ...
-
bioRxiv - Genomics 2021Quote: ... 5’-ENGRAM 2.0 recorder was digested with Xbal and Ncol (NEB, CutSmart buffer) at 37°C for 1h and purified ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 µL of linker ligation mixture was added (38% PEG-8000, 1x NEB T4 ligase buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Adenylation of R1R was done using 5’ DNA Adenylation kit (New England Biolabs) according to manufacturer’s instructions and cleaned with Oligo Clean & Concentrator (Zymo Research ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNAs were 5′-labeled with 32P-γ-ATP using T4 polynucleotide kinase (NEB) and purified on P-30 spin columns (Bio-Rad) ...
-
bioRxiv - Genomics 2022Quote: ... RNA was phosphorylated on the 5’ end using T4 polynucleotide kinase (NEB, M0201L) then ligated onto a 5’ adapter ...
-
bioRxiv - Genomics 2022Quote: ... then perform A-tailing with Klenow Fragment (3’-> 5’ exo-) (NEB, Cat. M0212S) provided with dATP ...
-
bioRxiv - Microbiology 2022Quote: ... golden-gate compatible template was created by 5’-phosphorylating with T4 PNK (NEB) and annealing of oligonucleotides ...
-
bioRxiv - Bioengineering 2022Quote: Escherichia coli (E. coli) strain NEB 5-α (New England Biolabs, Hertfordshire, UK) was used for generation of genetic constructs ...
-
bioRxiv - Bioengineering 2022Quote: ... the 5’ ends were phosphorylated with T4 Polynucleotide Kinase (New England Biolabs, M0201L). Each gene-specific pool of 51mer oligonucleotides was mixed with a 20mer ligation adapter (ACAGTCACTTCAACACTCAG ...
-
bioRxiv - Cell Biology 2022Quote: ... with 10 mM 10x Adenosine 5’-Triphosphate (1:10, #P0756S, New England Biolabs). The reaction was incubated in a thermocycler for 37 °C for 30 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ligation was directly transformed into NEB-5-alpha electrocompetent cells (NEB C2987H) and plated on LB-agar supplemented with carbenicillin (100 µg/mL) ...
-
bioRxiv - Biochemistry 2022Quote: DNA or RNA was labeled at 5′-termini with T4-Polynucleotide kinase (NEB) using ψ-P32-ATP as indicated in Figure 2 ...
-
bioRxiv - Molecular Biology 2019Quote: Synthesized guide RNAs were 5’-labeled with 32P using T4 PNK (NEB #M0201) and [γ-32P]ATP (Perkin Elmer #BLU002A250UC ...
-
bioRxiv - Genetics 2019Quote: ... and 5 U/µl DNA polymerase I Klenow (8 µl; New England Biolabs), and incubated for 90 min at 37°C with rotation ...
-
bioRxiv - Molecular Biology 2019Quote: ... Nucleotides were dephosphorylated by addition of 5 units of CIP (New England Biolabs) for another 2 hours at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... 8 μL of 5 M NaCL and 1 μL of RNase A (NEB) were added to every 200 μL of eluate and to the WCE samples (diluted to 200 μL with Elution buffer) ...
-
bioRxiv - Microbiology 2021Quote: ... The reaction mixture was then incubated with 5 units of Antarctic Phosphatase (NEB) for 1 h at 22 °C to hydrolyze unreacted GTP ...
-
bioRxiv - Microbiology 2021Quote: ... Bound RNA was degraded with 5 units of RNase H (New England Biolabs) and the cDNA purified by ethanol precipitation overnight at −20 °C (3x volumes of ethanol ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ phosphorylation and 3’ dephosphorylation were performed with T4 PNK (NEB, Cat: M0201S) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... and 5’ caps were removed by incubation with 20 U of RppH (NEB) for 1 h at 37 °C ...