Labshake search
Citations for New England Biolabs :
8651 - 8700 of 10000+ citations for Protein Digestion kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... The corresponding bands were cut out and pooled all in one tube followed by purification using the Monarch DNA Gel extraction Kit (T1020; NEB) and subsequently repurified using the DNA cleanup kit (T1030 ...
-
bioRxiv - Neuroscience 2023Quote: ... mRNA was eluted from the oligo-dT beads and fragmented by incubating with the First Strand Synthesis Reaction buffer and Random Primer Mix (2×) from the NEBNext Ultra II Directional Library Prep Kit for Illumina (#NEBE7760; New England Biolabs) for 15Lmin at 94°C ...
-
bioRxiv - Genomics 2023Quote: Directional poly(A)+ RNA-Seq libraries were prepared using 300 ng of DNase-treated RNA using the Poly (A) mRNA Magnetic Isolation Module and NEBNext Ultra II Directional RNA Library Prep kit for Illumina (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... RNA-seq poly-A libraries were generated with NEBNext UltraII directional RNA library prep kit for Illumina (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: Verification of modification of the pv6 locus was performed by first isolating genomic DNA from transfected parasites (Monarch genomic DNA isolation kit, New England Biolabs). Integration of targeting plasmid at the pfs47 locus was determined with primer pairs CVO119-CVO120 (wildtype locus and integrated locus) ...
-
bioRxiv - Immunology 2023Quote: ... The RNA sequencing libraries were generated using NEB Next Single Cell/Low Input RNA Library Prep Kit for Illumina (NEB) according to manufacturer’s protocol and sequenced on a NovaSeq 6000 sequencer (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... The RNA fusion targets were transcribed from plasmids using the HiScribe T7 High Yield RNA Synthesis Kit (NEB, Ipswich, MA), isolated using the Monarch Kit (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... total RNA samples from lungs at 4 dpi were subjected to library preparation using NEBNext Ultra II Directional RNA Library prep kit for Illumina (New England Biolabs) and sequenced on an Illumina NovaSeq 6000 with 150 base pair-end reads at Azenta ...
-
bioRxiv - Cancer Biology 2023Quote: ... Quality control and quantification of the resulting dual-indexed barcoded libraries was performed with Agilent TapeStation and by qPCR (NEBNext Library Quant Kit for Illumina, New England Biolabs).
-
bioRxiv - Genetics 2023Quote: ... whole genome bisulfite sequencing single indexed libraries were generated using NEBNext Ultra DNA library Prep kit for Illumina (New England BioLabs) according to the manufacturer’s instructions with modifications ...
-
bioRxiv - Molecular Biology 2023Quote: ... then adapter ligation was carried out using the sequencing adapters supplied with the kit and NEB Blunt/TA Ligase Master Mix (New England Biolabs).
-
bioRxiv - Molecular Biology 2023Quote: All RPL39 variants were cloned into the pRS413-GPD plasmid digested by the BamHI and SalI using the Gibson assembly kit (NEB). Guide blocks (IdT ...
-
bioRxiv - Genomics 2023Quote: Sequencing libraries were prepared with the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina (NEB, #E7765L) in 96-well plates ...
-
bioRxiv - Molecular Biology 2023Quote: ... The library was resolved on a 1% agarose gel and the smear between 300-600 bp was extracted using Monarch DNA Gel Extraction Kit (New England Biolabs).
-
bioRxiv - Genomics 2023Quote: ... we used the NEB Next PPFE repair kit with Ultra II end prep reaction (New England Biolabs, Ipswich, MA, USA) under recommended conditions and Nanopore ligation sequencing kit SQK-LSK110 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... PCR-based mutagenesis was carried out using the Q5® Site-Directed Mutagenesis Kit (New England Biolabs®, MA, USA) as per the manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA (5ng) was used for sequencing library construction using NEBNext Ultra II DNA Library Prep Kit for Illumina (Cat # E7645, NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and cloned into the vector pCE along with a 30 bp site specific spacer sequence (in the gene to be deleted) using Gibson assembly (Gibson Assembly Cloning Kit, New England Biolabs) using 1µg of fragments and plasmid at a 3:1 ratio then incubating at 50 °C for 4 hours ...
-
bioRxiv - Genomics 2023Quote: ... RNA sequencing libraries were prepared by NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB catalogue number E7760S). Libraries were sequenced as 150 bp paired-end reads using a Novaseq 6000 ...
-
bioRxiv - Immunology 2023Quote: ... Reverse transcription was performed on RNA samples using the ProtoScript II first strand cDNA synthesis kit (New England BioLabs; E6560S) with HRV serotype-specific reverse primers (Rev 5’- -3’) ...
-
bioRxiv - Immunology 2023Quote: ... pcDNA3.1-FLAG-ZBTB48 WT was used as template for the generation of the constructs with point mutations in the C-terminal arm using the primers in Table S6 and the Q5 Site-Directed Mutagenesis Kit (NEB). In brief ...
-
bioRxiv - Plant Biology 2023Quote: ... The reactions were completed in a final volume of 10 µl using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs), and relative gene expression analysis using the Livak method was per-formed 53 ...
-
bioRxiv - Neuroscience 2023Quote: ... RNAseq libraries were generated by the Cornell TREx Facility using the NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs) using 700ng input total RNA per sample ...
-
bioRxiv - Genomics 2023Quote: ... were used to remove rRNA from total RNA and libraries prepared using the NEBNext Ultra II Directional RNA Library Prep Kit (NEB, New England Biolabs). The libraries were sequenced on an Illumina NovaSeq S4 (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... was expressed from a pRS316-YEGFP-Pho8TMD-Atg15C background plasmid16 by substituting the CtAtg15(73–475) region for the ScAtg15(50–520) region using the NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs). All of the constructs were sequenced to confirm their identities.
-
bioRxiv - Microbiology 2023Quote: ... in combination with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina and NEBNext Multiplex Oligos for Illumina (Unique Dual Index Primer Pairs) (New England BioLabs). The resulting libraries were subjected to sequencing on a NextSeq 550 Sequencing System (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA libraries were generated using 1µg RNA with the magnetic mRNA isolation module and NEBNext Ultra II RNA Library Prep Kit for Illumina (New England Biolabs). DNA library was amplified by PCR and quality was analyzed using the fragment analyzer (Advanced Analytical) ...
-
bioRxiv - Cell Biology 2023Quote: ... were made by non-overlapping mutagenesis following the procedure described in the Q5 site-directed mutagenesis kit (New England Biolabs), using the pSS393 as template and divergent primers ...
-
bioRxiv - Cell Biology 2023Quote: ... The pSS459 plasmid driving the expression of PHOP1-GFP-pch2-nes4A was derived from pSS393 by using the NEBuilder assembly kit (New England Biolabs) and a synthesized gBlock fragment (IDT ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... the coding sequence of mCherry and eGFP sequence were linked into the pminiTol2 plasmid with a Gibson cloning kit (New England Biolabs) to generate pmini-eGFP-Lefty-Gdf1/3-like-mCherry construct ...
-
bioRxiv - Biochemistry 2023Quote: ... Reactions with UDP-MurNAc-80mer RNA contained 2 µg RNA and products were purified using the Monarch RNA Cleanup Kit (NEB).
-
bioRxiv - Biochemistry 2023Quote: The K164A mutant was made by site directed mutagenesis using wild type LhCE as template with the Q5 Site-Directed Mutagenesis Kit from NEB using following primers:
-
bioRxiv - Microbiology 2023Quote: ... All samples were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England BioLabs, #E7760L), with an initial amount of 100 ng total RNA in 12 μl ...
-
bioRxiv - Cell Biology 2023Quote: ... Both isoforms were cloned into a pcDNA 3.1 mammalian expression vector using an NEBuilder® HiFi DNA Assembly kit (cat # E5520S, New England Biolabs). We obtained human FAM161A cDNA in p3XFLAG-CMV-7 from Dr ...
-
bioRxiv - Plant Biology 2023Quote: ... pENTR221-Scs6 was used as a template to generate Scs6S793F and Scs6H510V via PCR mutagenesis using the Q5 Site-Directed Mutagenesis Kit (NEB).
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were generated according to the manufacturer’s instructions: polyA-selected RNA was isolated and libraries were prepared using the NEBNext kit (New England Biolabs, e7500s). Purified libraries were quantified on an Agilent Technologies 2200 TapeStation with a D1000 ScreenTape assay ...
-
bioRxiv - Biochemistry 2022Quote: ... The resulting RNA was used to generate cDNA using the LunaScript®RT SuperMix Kit according to the manufacture’s protocol (New England Biolabs).
-
bioRxiv - Biochemistry 2023Quote: ... The products were purified using the Zymo Research kit and eluted with 6 uL water and 1 uL was electroporated into DH10B cells (NEB). Electroporated cells were recovered in 975 uL of LB and plated on LB agar containing carbenicillin (100 μg/ml ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 30 ng of methylated DNA was used to generate the NGS (Next-Generation Sequencing) library by using the NEBNext ULTRA DNA Library Prep Kit for Illumina (New England Biolabs) and the NEBNext Multiplex Oligos for Illumina (New England Biolabs ...
-
bioRxiv - Developmental Biology 2023Quote: ... an SP6 promoter was inserted upstream of the transcriptional start using Q5 Site-Directed Mutagenesis Kit (New England Biolabs, #E0554S). All plasmids were confirmed by sequencing.
-
bioRxiv - Biochemistry 2023Quote: ... DNA assembly was performed to join R7-DD and R9-DD to linearised the GFP-cBAK vector using the NEBuilder HiFi DNA assembly kit (NEB).
-
bioRxiv - Bioengineering 2023Quote: ... in vitro transcription (used in experiments in figures otherwise) from the SB100x plasmid using the HiScribe T7 ARCA mRNA (with tailing) Kit (NEB). Following RNA transcription in vitro ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... RNA library preparation was performed on total or polysomal RNA using a NEBNext Poly(A) mRNA Magnetic Isolation Module and a NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs) according to the manufacturer’s instructions with 1 μg of RNA as a starting point ...
-
bioRxiv - Immunology 2023Quote: ... The following primers were used to amplify the Mpro sequence from cDNA with the Phusion polymerase kit (New England BioLabs). F:AATAAGGTACCAGTGGTTTTAGAAAAATGG ...
-
bioRxiv - Cancer Biology 2023Quote: ... The mutation for generating BN-CD38Mut was introduced to BN-CD38 with Q5 Site-Directed Mutagenesis kit (New England Biolabs). Both were produced transiently in ExpiCHO cells (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... Library construction: The RNA sequencing library was constructed using NEBNext® Ultra II RNA Library Prep Kit (New England Biolabs) according to the manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2022Quote: ... Non-directional sequencing libraries were completed with the “NEBNext Ultra II FS DNA Library Prep Kit for Illumina” (NEB #E7805) and subsequently analyzed on an Illumina NextSeq 550 with v2.5 reagent kits following manufacturer’s protocols.
-
bioRxiv - Cell Biology 2023Quote: ... was introduced into an existing pZDonor-AAVS1-CAG-HA-KLF1-ERT2-PolyA plasmid (28) via site-directed mutagenesis using the Q5 Site-Directed Mutagenesis Kit (E0554S, New England BioLabs) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Purified DNA was submitted to NGS library preparation using NEBNext Ultra II DNA Library Prep Kit (New England BioLabs, E765) and sequenced with NovaSeq 6000 (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... Eluted DNA was used for qPCR or sequencing library preparation with NEBNext Ultra II DNA Library Prep Kit (NEB; E7645) according to the manufacturer’s protocol.