Labshake search
Citations for New England Biolabs :
8501 - 8550 of 9501 citations for FabFc ZAP rat Antibody Internalization Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... Sequencing libraries were constructed using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (E7760, New England BioLabs, Ipswich, MA). The library preps were started with 92-1000 ng of total RNA ...
-
bioRxiv - Genomics 2019Quote: ... were used to PCR amplify both wild type and RRM3 Mt cDNA inserts for ligation into a pET28b vector containing an N-terminal 10xHis-SUMO tag using the Quick Ligation kit (NEB, Ipswich, MA). Plasmids containing the cDNA of interest were verified by Sanger sequencing prior to expression (Quintara Biosciences ...
-
bioRxiv - Genomics 2020Quote: ... In vitro transcription was done using the HiScribe T7 High Yield RNA Synthesis Kit according to the manufacturer’s instructions (New England Biolabs, Ipswich, MA, USA).
-
bioRxiv - Genomics 2020Quote: ... a library without the enrichment method was also processed using NEBNext® Ultra™ II FS DNA Library Prep kit following the manufacturer’s recommendations (New England Biolabs, USA). The library preparation for D ...
-
bioRxiv - Microbiology 2019Quote: ... and also quantified using NEB Luna Universal qPCR Master Mix and Luna Universal One-Step RT-qPCR Kit (New England Biolabs, Ipswich, MA) for qPCR and RT-qPCR test ...
-
bioRxiv - Molecular Biology 2019Quote: M6A and m1A immunoprecipitationwere adapted from the protocols provided in the EpiMark® N6-Methyladenosine Enrichment Kit (NEB #E1610S, New England BioLabs Inc) and that previously described (28) ...
-
bioRxiv - Physiology 2020Quote: RNA was extracted from cultured cells or tissue (∼10 mg) stored in RNALater® using Monarch® Total RNA Miniprep Kit (New England BioLabs). For maximal RNA recovery ...
-
bioRxiv - Molecular Biology 2020Quote: ... dsDNA templates were then in vitro transcribed using the HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs, Ipswich, MA) using overnight incubation as described in the protocol for <0.3kb transcripts.(28 ...
-
bioRxiv - Biochemistry 2019Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and quantified by qPCR on a Bio-Rad CFX Connect Real-Time PCR detection system with the NEBNext Library Quant Kit for Illumina (New England Biolabs, catalog # E7630L). The libraries were normalized to 10 nM ...
-
bioRxiv - Microbiology 2019Quote: ... and 7 cycles of PCR to enrich for ligated product was done with NEBNext® Ultra™ DNA Library Prep Kit for Illumina (New England Biolabs). Libraries were quantitated with KAPA Library Quantification Kits for Next-Generation Sequencing (Roche Sequencing Solutions ...
-
bioRxiv - Systems Biology 2019Quote: ... Adapters were ligated to FAIRE DNA (300 ng) using NEBNext® Ultra™ II DNA Library Prep Kit (NEB Catalog No. E7645S). After U excision step ...
-
bioRxiv - Biophysics 2019Quote: ... HIV-1 MAG2A-ΔHBR-EGFP was generated from HIV-1 MAG2A-EGFP by deleting amino acids 18-32 using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs, Ipswich, MA). pEGFP-N1 and pEYFP-N1 were obtained from Clonetech (Mountainview ...
-
bioRxiv - Molecular Biology 2020Quote: ... 70 ng genomic DNA was used to prepare paired-end libraries with the NEBNext Ultra II FS DNA Library Prep Kit (New England Biolabs, Ipswich, MA) using only 10% of the reagents recommended in the original protocol of the supplier ...
-
bioRxiv - Physiology 2019Quote: PCR templates generated as described above (see Table S3) were used for in vitro transcription reactions using the HiScribe T7 RNA Synthesis Kit (New England Biolabs, Whitby, ON) following the recommended conditions when using modified nucleotides ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... the NGS libraries were created from mRNA isolated using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NewEngland BioLabs, Ipswich, Massachusetts). Final libraries were sequenced on a Illumina NextSeq 500 on a high output flowcell with 2×75 bp paired-end read lengths.
-
bioRxiv - Microbiology 2019Quote: Illumina paired-end sequencing libraries were prepared from genomic DNA using the NEBNext® Ultra™ DNA Library Prep Kit according to the manufacturer’s protocol (New England Biolabs, UK) and sequenced by standard procedures on the Illumina MiSeq platform ...
-
bioRxiv - Plant Biology 2019Quote: ... Three different biological replicates represented by total RNA extracted from three individual plants and reverse transcribed into cDNA by LunaScript®RT SuperMix Kit (New England Biolabs Inc.) were used for statistical analysis of the quantification ...
-
bioRxiv - Microbiology 2019Quote: ... 10 (GSF1697) or 12 (GSF2248) PCR cycles were run using 8-nt barcoded oligos from NEBNext Multiplex Oligos barcode kit (NEB cat# 6609S). The libraries were purified with Agencourt AMPure XP beads ...
-
bioRxiv - Microbiology 2019Quote: ... 30 and 100 days were fragmented into ∼150 bp segments and prepared for sequencing using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina in combination with the NEBNext Multiplex Oligos for Illumina (New England BioLabs, Ipswich, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2019Quote: ... the CggR mutant variant R250A was inserted in the above generated plasmids (replacing the CggR wt) using the NEB Gibson assembly kit (New England Biolabs, MA, US). 5 µl of reaction mix was transformed into chemical competent E ...
-
bioRxiv - Molecular Biology 2021Quote: ... and final RNA-seq libraries generated using the NEBNext Ultra II Directional RNA Library Prep kit (NEB, E7760 and NEBNext Multiplex Oligos (NEB, E7335/E7500). Final libraries were sequenced as 150 bp paired-end reads on the Illumina HiSeq platform.
-
bioRxiv - Evolutionary Biology 2020Quote: ... Total RNA was extracted with a standard TRIzol RNA extraction and chloroform/isopropanol precipitation and cDNA was prepared with the ProtoScript II First Strand cDNA synthesis kit (New England Biolabs, Frankfurt, Germany). For each sample ...
-
bioRxiv - Microbiology 2020Quote: ... The sequencing library was prepared using the NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs; Ipswich, Massachusetts, USA) and was sequenced on a single lane of a HiSeq 2500 (Illumina ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Library preparations were performed using the NEBNext Ultra II DNA Library Prep Kit for Illumina with the NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1) (NEB, Ipswich, Massachusetts). Library preparation followed the protocol outlined in Saeidi et al ...
-
bioRxiv - Cancer Biology 2019Quote: ... The amplified gene was fused to different DT variants using the NEBuilder® HiFi DNA Assembly Cloning Kit (New England Biolabs Inc.). DNA sequence corresponding to CPD (nucleotides nt 12269-12894 of rtxA1 ...
-
bioRxiv - Genomics 2021Quote: ... 1.5 µg of high-molecular-weight genomic DNA was subjected to end repair using the NEBNext Ultra II End Repair kit (NEB, cat. #E7445) and purified using 1x AmPure beads (Beckman Coulter Life Sciences ...
-
bioRxiv - Microbiology 2021Quote: ... Around 1 µg of each PCR product was used as template for dsRNA synthesis using the HiScribe T7 High Yield RNA synthesis kit (New England BioLabs, Cat # E2040S) as per the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Metagenomic libraries for the first two timepoints were prepared with NEBNext® Ultra™ DNA Kit (New England Biolabs, Cat. No. E7370) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was isolated using the Zymo Quick-RNA Viral kit and converted to cDNA using Protoscript II (New England Biolabs, Ipswich, MA) as follows ...
-
bioRxiv - Biophysics 2022Quote: PME measurements were carried out using a transient expression vector we created by inserting a synthetic gene block encoding the cDNA sequence of the human β2AR (Integrated DNA Technologies, Coralville, IA) into a modified pcDNA5 FRT using the NEBuilder kit (New England Biolabs, Ipswitch, MA). The final construct was designed to generate β2AR bearing an N-terminal influenza hemagglutinin tag from a transcript that also features a downstream internal ribosome entry site (IRES)-dasher GFP cassette that facilitates the unambiguous identification of positively-transfected cells ...
-
bioRxiv - Bioengineering 2021Quote: ... 500 ng of DNA was used for WGS library preparation using the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (New England Biolabs, MA, USA). Fractionated ...
-
bioRxiv - Bioengineering 2021Quote: ... The RNA-seq library was then generated using the NEBNext® Ultra™ RNA Library Prep Kit for Illumina® (NEB, USA). Library quality was assessed using the Agilent Bioanalyzer 2100 system ...
-
bioRxiv - Microbiology 2021Quote: ... nucleic acid (5 μL) was used as template for reverse transcription using LunaScript® RT SuperMix Kit (New England Biolabs, Hitchin, UK) in 20 μL reaction volume ...
-
bioRxiv - Bioengineering 2020Quote: ... The point mutation in dCas9 to create H840A Cas9n was made using Q5® Site-Directed Mutagenesis Kit (New England Biolabs, US). DNA assembly was mainly done by using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs ...
-
bioRxiv - Bioengineering 2020Quote: ... Addgene plasmid #44249)30 by site-specific mutation of 10A of dCas9 to 10D using Q5® Site-Directed Mutagenesis Kit (New England Biolabs, US). Secondly ...
-
bioRxiv - Neuroscience 2020Quote: ... 300 ng of total RNA from each sample was submitted for ribosomal RNA depletion using the NEBNext rRNA Depletion kit (New England Biolabs, Massachusetts, USA), and RNA-seq libraries were constructed using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... and 7 microliters of diluted material were used for first strand cDNA synthesis using ProtoScript® II First Strand cDNA Synthesis Kit (New England Biolabs #E6560) with random hexamers and following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... The RNA extraction and library preparation were performed by Novogene Company Limited with NEB Next® Ultra™ RNA Library Prep Kit (NEB) prior to RNA sequencing (paired-end 150 bp ...
-
bioRxiv - Cell Biology 2021Quote: ... and samples were prepared for sequencing from 400 ng of total RNA using NEBNext Ultra II Directional RNA Library Kit for Illumina with poy(A) mRNA enrichment (NEB, E7760, E7490) according to the manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2020Quote: ... DNA fragment repair and library adaptor ligation were performed using NEBNext® Ultra™ DNA Library Prep Kit for Illumina (New England Biolabs), in accordance with the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... 0.5 µg of total RNA was used to generate first-strand cDNA using the Protoscript II First Strand cDNA Synthesis Kit (New England Biolabs, Ipswich, MA). The resulting cDNA was subjected to qPCR using human gene-specific primers for AAK1 ...
-
bioRxiv - Genomics 2020Quote: ... 100 ng of microbial gDNA was fragmented using Covaris S2 instrument to a mean size of 250 bp and used as input to the NEBNext Ultra II kit (E7645 New England Biolabs Ipswich, MA) and checked for quality using the Agilent Bio-analyzer 2100 and Qubit spectrofluotometer ...
-
bioRxiv - Pathology 2021Quote: ... flanks fragments of bcptp1 gene were amplified and respectively cloned into the upstream and downstream regions of hph cassette using Gibson Assembly Master Mix kit (New England Biolabs, Massachusetts, USA). The overexpression plasmid OEBcPTP1- pH2G was generated that the full-length open reading frame of bcptp1 was cloned into the pH2G vector under the regulation of B ...
-
bioRxiv - Plant Biology 2021Quote: ... We used 10 ng of IP or input DNA for ChIP-Seq library construction using NEBNext® Ultra DNA Library Prep Kit for Illumina® (New England Biolabs) according to manufacturer’s recommendations ...
-
bioRxiv - Plant Biology 2021Quote: ... the mutant gfp1a and gfp1b were created by inserting a gblcoks containing frame shift mutation sequences at the 5’ end of GFP coding sequence of pGFPGUSPlus (Plasmid #64401 in addgene) using the NEBuilder HiFi DNA Assembly Cloning Kit (New England BioLabs, Catalog #E5520S). Then ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA-seq libraries were then prepared from the mRNA using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, Massachusetts, USA). Libraries were quantified by a fluorimetric method and their quality assessed on a Fragment Analyzer (Agilent Technologies) ...
-
Cis-regulatory divergence underpins the evolution of C3-C4 intermediate photosynthesis in MoricandiabioRxiv - Plant Biology 2021Quote: ... The DNA fragment was inserted into pCambia1381 by homologous recombination using the Gibson Assembly Cloning kit (New England Biolabs, catalog number: E5510S). The predicted promoter region of the PHOT2 gene of M ...
-
bioRxiv - Plant Biology 2021Quote: ... #ltp1.4ltp1.8-1 and #ltp1.4ltp1.8-2) were chosen for constructing next generation sequencing libraries following the manufacture’s protocol (NEB Next Ultra II DNA kit). Sequencing was carried out using 2 × 150 paired-end NextSeq500 (1-2 Mio reads for all samples together ...
-
bioRxiv - Cell Biology 2021Quote: ... Amplification of cDNA was conducted using T7 forward primers and cDNA-based RNA was generated using HiScribeTM T7 Quick High-Yield RNA Synthesis kit (New England Biolabs, Ipswich, MA). T7 RNA (1 μg ...