Labshake search
Citations for New England Biolabs :
801 - 850 of 1857 citations for Sodium Voltage Gated Channel Alpha Subunit 10 SCN10A Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... by incubating with 10 U of T4 polynucleotide kinase (New England Biolabs) at 37°C for 1 h.
-
bioRxiv - Molecular Biology 2023Quote: ... and then transformed into NEB 10-beta competent cells (New England BioLabs). Plasmid DNA was extracted from ten positive clones using the GeneJET Plasmid Miniprep Kit (Thermo Scientific ...
-
bioRxiv - Genomics 2023Quote: ... 10 µL of 400 U/µL T4 DNA Ligase (Cat#M0202, NEB), and 562 µL of water was added ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 µL Q5® High GC Enhancer (New England BioLabs, Inc., B9028AVIAL), 0.5 µL Q5® High-Fidelity DNA Polymerase (New England BioLabs ...
-
bioRxiv - Biophysics 2022Quote: ... and 10 units of T4-polynucleotide kinase (New England BioLabs, Ipswich, MA) in 70 mM Tris/HCl pH7.6 ...
-
bioRxiv - Genomics 2023Quote: ... 10 μL of Digestion-3 mix (5 U NotI-HF (NEB, R3189L) in 1X CutSmart buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 μL of 10 mM dNTP mix (NEB N0447S, Ipswich, MA). This initial premix was heated at 65°C for 5 minutes ...
-
bioRxiv - Genomics 2023Quote: ... 1 μl 10 mM mix of dGTP and dTTP (NEB #N0442S, #N0443S), 5 μl 10x T4 DNA Ligase Buffer ...
-
bioRxiv - Genomics 2023Quote: ... 12 μL of 10 mg/mL Bovine Serum Albumin (100 × BSA, NEB), 5 μL of 400 U/μL T4 DNA Ligase (NEB #M0202) ...
-
bioRxiv - Biophysics 2023Quote: ... and dGTP were incubated and 10 units of DNA polymerase 1 (NEB) for 6 minutes at 37°C ...
-
bioRxiv - Systems Biology 2023Quote: ... 10 μl of NEB T4 ligation buffer (New England Biolabs, Ipswitch, MA), 5 μl of NEB T4 ligase (New England Biolabs ...
-
Bio-orthogonal Glycan Imaging of Culture Cells and Whole Animal C. elegans with Expansion MicroscopybioRxiv - Bioengineering 2024Quote: ... and treated with 10 mM DTT and Proteinase K (New England Biolabs) at 8 units/mL in digestion buffer (50 mM Tris (pH 8) ...
-
bioRxiv - Cell Biology 2023Quote: ... freshly supplemented with 10 U/ ml proteinase K (P8107S, New England Biolabs). Plates were slightly tilted to ensure the coverslip was completely covered and incubated at room temperature overnight ...
-
bioRxiv - Genomics 2024Quote: ... and the top 3 sgRNAs were individually cloned into single sgRNA expression vectors with direct capture cs1 sequences (Addgene # 122238)10 using restriction digest (BstXI and BlpI) and T4 ligation (NEB # M0202M). A non-targeting sgRNA sequence was included as well ...
-
bioRxiv - Biochemistry 2023Quote: ... 2.5 μL 10 mM MnCl2 and 2 μL Lambda Protein Phosphatase (NEB). The dephosphorylation reaction was allowed to occur at 30 °C overnight ...
-
bioRxiv - Immunology 2023Quote: ... 2 μL of T4 RNA Ligase (10 000 U/mL, NEB, M0204S), and 10 μL of PEG 8000 50% (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... Beads were treated with 10 μl of T4 Polynucleotide kinase (PNK; NEB) in 100 μl of 1X T4 PNK Reaction buffer containing 1 U/μl SUPERase•In™ RNase Inhibitor at 37°C for 30 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... were added with 1.5 µL of 10× GlycoBuffer 1 (New England Biolabs) in the sample by adjusting with Milli-Q H2O to total 15 µL ...
-
bioRxiv - Biochemistry 2024Quote: ... Correct constructs were re-transformed into 10-beta chemically competent cells (NEB), from which clones were used to prepare glycerol stocks (25% glycerol ...
-
bioRxiv - Genomics 2024Quote: ... and dephosphorylated 10 minutes at 37°C using Quick CIP (NEB, M0525). The vectors were then purified with PCR CleanUp kit (Macherey Nagel ...
-
bioRxiv - Immunology 2024Quote: ... with 10 × DNase I buffer diluted in water (New England Biolabs #M0303S). Samples were incubated in the thermocycler for 30 minutes at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... beads were incubated with 10 μM SNAP-Surface Alexa Fluor 488 (NEB) for 1 hour at 4°C prior to elution ...
-
bioRxiv - Bioengineering 2020Quote: Antibodies were first digested with PNGase F (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... or 5 µl anti-H3K18cr antibody (PTM-517, PTM Biolabs) together with protein A agarose (Roche ...
-
bioRxiv - Cell Biology 2021Quote: ... and MBP was detected with MBP antibodies (New England Biolabs).
-
bioRxiv - Biochemistry 2023Quote: ... mouse monoclonal antibodies against PAR (clone 10H, Tulip BioLabs, USA), anti-mouse antibodies conjugated with horseradish peroxidase (Bio-Rad ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 μl anti-MBP Monoclonal Antibody (New England Biolabs, #E8032L) and 6 μl anti-E ...
-
bioRxiv - Synthetic Biology 2021Quote: ... coli K-12 strain NEB DH-10 Beta (New England Biolabs, MA, USA) unless stated otherwise ...
-
bioRxiv - Cancer Biology 2020Quote: ... The bound fusion protein was eluted with 10 mM maltose (New England Biolabs). The yield of the fusion proteins was evaluated by separation on SDS-PAGE and visualization via Coomassie blue staining.
-
bioRxiv - Developmental Biology 2021Quote: ... 10 μg of nucleic acid was digested with 5 μL RNase H (NEB) at 37°C for 16 hours and 10 μg was mock digested without RNase H ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.4 μl of 10 U/μl T4 DNA ligase (4U final, NEB M0202L), 1X T4 DNA ligase reaction buffer ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 1 μL of 10 mM dNTPs (New England Biolabs, Ipswich, MA, USA) to 10 μL RNA and incubating at 65°C for 5 min on a C1000 Touch Thermal Cycler (Bio-Rad ...
-
bioRxiv - Biophysics 2021Quote: ... following incubation for ∼2 hours of 10 mg/ml BSA (New England Biolabs) diluted in buffer A containing 20 mM Tris ...
-
bioRxiv - Molecular Biology 2021Quote: ... 20 μL of 1× PNK mix (2 μL of 10× PNK buffer (NEB), 2 μL ATP (SCP801 ...
-
bioRxiv - Cell Biology 2022Quote: ... 1/10 T7 RNA polymerase mix (HighScribe T7 High Yield RNA synthesis NEB)) at 37°C ...
-
bioRxiv - Genomics 2019Quote: ... A 10 μL reaction was prepared containing 1x NEBuffer 3.1 (New England Biolabs), 5 units of endonuclease ...
-
bioRxiv - Genomics 2019Quote: ... A 10 μL reaction was prepared containing 1x ThermoPol buffer (New England Biolabs), 0.25 units of polymerase ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μM dNTPs (0.5 μl per reaction) in 1× Klenow reaction buffer (NEB). Next ...
-
bioRxiv - Genomics 2020Quote: ... and the resulting product was transformed into 10-Beta Electrocompetent cells (NEB C3020K). We plated 1% of the library to estimate complexity and grew the rest of the sample and then midi prepped (Zymo D4200 ...
-
bioRxiv - Molecular Biology 2019Quote: ... XPG solution was mixed with 10 ml of amylose resin (New England BioLabs) pre-equilibrated in dialysis buffer ...
-
bioRxiv - Genomics 2019Quote: ... This gDNA was then digested with DpnI (10 U, New England Biolabs #R0176L) in CutSmart buffer in a total volume of 10 µl at 37 °C for 8 h followed by heat inactivation at 80 °C for 20 min ...
-
bioRxiv - Biochemistry 2020Quote: ... RNA was resuspended in 10 μl of nuclease free water (New England Biolabs). 5 μl of RNA solution was suspended in 5 μl of RNA loading buffer (95% (v/v ...
-
bioRxiv - Genomics 2021Quote: ... 1 µL of 10 U/µL polynucleotide T4 kinase and PNK buffer (NEB) in 20 µL ...
-
bioRxiv - Genetics 2020Quote: ... followed by gap repair by adding 2 µl of 10× NEBuffer 2 (NEB), 3 µl of dNTPs (2.5 mM each ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNAsin was replaced with 10 mM ribonucleoside vanadyl complex (New England Biolabs S1402S) was added to the ground tissue ...
-
bioRxiv - Cell Biology 2021Quote: ... and 10 mM ribonucleoside vanadyl complex (RVC; S1402S; New England Biolabs; Ipswich, MA) for 10–20 min in a 37°C water bath ...
-
bioRxiv - Bioengineering 2021Quote: ... 10 ng of purified PCR products were incubated with I-SceI endonuclease (NEB) according to manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2019Quote: ... 100 ng of genomic DNA was digested with 10 units of HhaI (NEB) and 2 units of HaeIII (NEB ...
-
bioRxiv - Genetics 2021Quote: ... 10 μl of Q5 Hot Start High-Fidelity 2x Master Mix (NEB M0494S), 1 μl of 10 μM shRNA_GA_F primer (5’ GAGAACTCTGAATAGATCTGTTCTAGAAAACATCCCATAAAACATCCCATATTCA-3’) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 μL 400 U μl-1 T4 DNA Ligase (NEB, high concentration formula) and 664 μL H2O and incubated for 120 mins at 23°C with 300 rpm slow rotation ...