Labshake search
Citations for New England Biolabs :
801 - 850 of 4181 citations for 7 nitro 3 phenyl 1 naphthol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... 3 μg of the final overexpression plasmids were linearized with either SmaI or AscI (New England Biolabs) and transformed consecutively into the DasKO strain as mentioned above ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA fragments were directly 3’-end dephosphorylated using 5 U of Antarctic Phosphatase (New England Biolabs, UK) for 30 minutes at 37°C ...
-
bioRxiv - Biochemistry 2022Quote: ... The 3-4FnIII fragment and randomized 5FnIII domain were digested with BsmBI-v2 (New England Biolabs R0739S), purified by PCR cleanup kit (Fisher Scientific FERK0702) ...
-
bioRxiv - Microbiology 2023Quote: ... All 3 fragments were amplified from pTRL2-His-GrgA 36 using Q5 DNA polymerase (New England Biolabs). Fragment 1 was generated using primers pgp3-pgp4-F and His-RBS-R (Table S1) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The bicistronic reporters used to detect regulatory elements within 3′ UTRs were constructed by Gibson Assembly (NEB) and standard methods ...
-
bioRxiv - Molecular Biology 2022Quote: 3’ linker ligation (1x PNK buffer, 800 U T4 RNA ligase 2 truncated KQ (NEB, Cat#M0373L), 80 U RNaseOUT ...
-
bioRxiv - Molecular Biology 2023Quote: For short read sequencing 3 μg yeast genomic DNA was digest with NEBNext dsDNA Fragmentase (NEB; # M0348S) in Fragmentase Reaction Buffer v2 at 30 °C for 30 min before stopping the reaction with EDTA ...
-
bioRxiv - Cell Biology 2023Quote: ... crosslinked RNA fragments were dephosphorylated at their 3’ ends using T4 Polynucleotide Kinase (New England Biolabs, M0201S) and ligated to a pre-adenylated 3’ adapter (L3-App) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the 3’adapter was ligated to the dephosphorylated RNA using T4 RNA ligase 2 KQ (NEB, M0373L) at 25°C for 1h ...
-
bioRxiv - Microbiology 2023Quote: ... was constructed by assembling 3 DNA fragments using the NEBuilder HiFi DNA assembly kit (New England Biolabs). All 3 fragments were amplified from pTRL2-His-GrgA (28 ...
-
bioRxiv - Microbiology 2023Quote: ... All 3 fragments were amplified from pTRL2-His-GrgA (28) using Q5 DNA polymerase (New England Biolabs). Fragment 1 was generated using primers pgp3-pgp4-F and His-RBS-R (sTable 5) ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA 3′-ends were dephosphorylated in a 10 µL reaction with 2 µL T4 PNK (NEB #M0201S) 1 µL of FastAP Thermosensitive Alkaline Phosphatase (ThermoFisher #EF0651) ...
-
bioRxiv - Molecular Biology 2023Quote: RNA 3′-ends were dephosphorylated in a 10 µL reaction with 2 µL T4 PNK (NEB; #M0201S) 1 µL of FastAP Thermosensitive Alkaline Phosphatase (ThermoFisher #EF0651) ...
-
bioRxiv - Genetics 2023Quote: ... and A10 (Supplementary Table 3) were re-folded prior complexation with SpCas9 (Cas9 Nuclease, S. pyogenes; NEB), SpRY ...
-
bioRxiv - Microbiology 2023Quote: ... CVO689-CVO586 (integrant 5’ end) and CVO321-CVO183 (integrant 3’ end) using Q5 Polymerase (New England Biolabs). PCRs were set up according to manufacturers’ instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... HeLa cells expressing ATP5I-SNAP were stained with 3 µM SNAP-cell 647-SiR (Silicon rhodamine) (NEB) for 30 min ...
-
bioRxiv - Microbiology 2023Quote: ... was constructed by assembling 3 DNA fragments using the NEBuilder HiFi DNA assembly kit (New England Biolabs). All 3 fragments were amplified from pTRL2-His-GrgA 36 using Q5 DNA polymerase (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 μM of each forward and reverse DNA oligos were annealed in T4 DNA Ligase buffer (NEB) by heating to 95° C for 5 mins then cooling at a rate of 4°C every 2 minutes until ambient temperature was reached ...
-
bioRxiv - Systems Biology 2023Quote: ... N6-(6-Azido)hexyl-3’-dATP were added to ssDNA oligos (Biolegio) using terminal transferase (TdT, NEB) at 25:1 molar ratio for 2h at 37°C ...
-
Atypical epigenetic and small RNA control of transposons in clonally reproducing Spirodela polyrhizabioRxiv - Plant Biology 2024Quote: ... were ligated to 3′ barcoded DNA adapters using truncated T4 RNA ligase 2 (New England Biolabs, #M0373). These fragments were separated in an 12% denaturing polyacrylamide-urea gel ...
-
bioRxiv - Molecular Biology 2024Quote: ... crosslinked RNA fragments were dephosphorylated at their 3’ ends using T4 Polynucleotide Kinase (New England Biolabs, M0201S) and ligated to a pre-adenylated 3’ adapter (L3-App) ...
-
bioRxiv - Biochemistry 2024Quote: ... the concentrated protein at 3 mg/mL was incubated with c-AMP Protein Kinase A PKA (NEB) (molar ratio of 40:1 ...
-
bioRxiv - Biochemistry 2024Quote: ... which was dephosphorylated at the 5’-end with 3 µl of Quick-CIP (5000 U/µl, NEB) in a total volume of 20 µl according to manufactureŕs instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The 3’ ends of the VSV G and GP64 ORFs were PCR-amplified (using Taq polymerase, NEB) from DNA isolated from each fly line ...
-
bioRxiv - Genomics 2024Quote: ... along with a 4.8uL 3:2 master mix of T4 ligase buffer:T4 ligase (New England Biosciences, NEB) and 9.4uL of nuclei buffer with BSA (NBB ...
-
bioRxiv - Evolutionary Biology 2021Quote: 3’ dephosphorylation was performed by incubating fragments with 10 U/uL T4 Polynucleotide Kinase (New England Biolabs M0201S) in the supplied buffer (NEB B0201S ...
-
bioRxiv - Neuroscience 2021Quote: NFIB 3’ UTR and 5’ UTR HP forming regions were in vitro transcribed using T7 transcriptase (NEB, E2040) and purified with Trizol extraction (described in RT-qPCR paragraph) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5’-monophosphate standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with Apyrase (NEB). The 5’-hydroxyl standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with calf intestinal phosphatase (NEB) ...
-
bioRxiv - Molecular Biology 2019Quote: ... About 2-3 μg of source DNA plasmid (<10 kb) was added with NEBuffer 3.1 (NEB, cat# B7203S), DEPC ddH2O in a volume of 30 μl and incubated at 37 °C for >2 hour (h) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... This fragment was generated by a standard 3-step PCR protocol using Phusion DNA polymerase (New England Biolabs) and then cloned into the XbaI and HindIII sites of pEX18A (Prentki and Krisch ...
-
bioRxiv - Molecular Biology 2019Quote: ... Fragmented RNA was then subjected to RNA 3’ linker ligation using T4 RNA Ligase I (New England Biolabs) and reverse transcription using a primer complementary to the linker sequence and SuperScript III (ThermoFisher ...
-
bioRxiv - Genomics 2020Quote: ... RNA was resuspended in 5 μl of water and the 3′ ends dephosphorylated with PNK (New England BioLabs) in MES buffer (100 mM MES-NaOH ...
-
bioRxiv - Bioengineering 2020Quote: ... and the 3’ extension were ligated together into the digested vector using Quick Ligase or T4 Ligase (NEB) to generate the complete pegRNA plasmid ...
-
bioRxiv - Neuroscience 2019Quote: ... Ten microliters of PCR products were digested with Nsi1 (3 hours with 5 units of Nsi1 enzyme (NEB)) and then ...
-
bioRxiv - Synthetic Biology 2021Quote: ... qPCR was carried out using the primers in Supplementary Table 3 and Luna Universal qPCR Master Mix (NEB) in a BioRad iCycler in technical triplicates for each biological replicate ...
-
bioRxiv - Immunology 2021Quote: ... we modified the plasmid using primers EpMap_1 and EpMap_2 along with ssODN EpMap1_ssODN (Extended Data Table 3) using the NEBuilder Mastermix (NEB, E2621S) following the manufacturer’s instructions in order to create hairpin-free overlap regions that could be used for homology-based library cloning ...
-
bioRxiv - Microbiology 2022Quote: ... 2.5µL of 10µM MBTUni-12 primer + 2.5µL of 10µM MBTUni-13 primer (5’-ACGCGTGATCAGTAGAAACAAGG-3’) + 10µL 5x HF Phusion Buffer + 1µL 10mM dNTPs mix (NEB #N0447S) + 0.5µL Phusion Polymerase + 28.5µL of Nuclease-free water (Ambion ...
-
bioRxiv - Molecular Biology 2020Quote: ... was added at 3’end of RA5) was ligated to RNA using T4 RNA ligase (New England Biolabs) at 25°C for 6 hr and 22°C for 6 hr ...
-
bioRxiv - Molecular Biology 2019Quote: ... HIS3_hp_For 5′ AAAAGCTTGACCGAGAGCAA and HIS3_hp_Rev 5′ GCGTATTACAAATGAAACCAAGATTCA) and initially cloned into pRS405 (3) between HindIII and XhoI (NEB). A DNA segment containing the GAL1 promoter ...
-
bioRxiv - Microbiology 2019Quote: The DNA oligo i116 that served as a 3’ adapter was adenylated using 5’ DNA Adenylation Kit (NEB), purified by ethanol precipitation as above and diluted to 10 μM with nuclease-free water.
-
The absence of C-5 DNA methylation in Leishmania donovani allows DNA enrichment from complex samplesbioRxiv - Molecular Biology 2020Quote: ... and cloned between 300 bp of PCR amplified DNA fragments of the LdBPK_250018100.1 5’ and 3’ UTR using NEBuilder (NEB) inside pUC19 for construct amplification in E ...
-
bioRxiv - Molecular Biology 2021Quote: ... Homology arms and exon 3 of the murine Akr1b3 locus were amplified with Q5 polymerase (New England Biolabs) using genomic DNA from mouse R1 ES cells (23) ...
-
bioRxiv - Genomics 2021Quote: The beads were magnetically separated and resuspended in 20 µl of 3’ end RNA dephosphorylation mixture (4 µl 5x PNK pH 6.5 buffer, 0.5 µl PNK [New England Biolabs; with 3’ phosphatase activity] ...
-
bioRxiv - Systems Biology 2021Quote: ... Adaptors for Illumina sequencing were added via PCR amplification using Nspacer_barseq_pHIMAR (Wetmore et al., 2015) and NEBNext Index 3 Primer for Illumina (New England Biolabs). Cycle conditions were 30 seconds 98°C followed by 4 cycles (15 seconds 98°C ...
-
bioRxiv - Microbiology 2021Quote: ... 3 µL NEB Ultra II End-prep Enzyme Mix and 2 µL NEBNext FFPE DNA Repair Mix (NEB) were added to the DNA (final volume 60 µL) ...
-
bioRxiv - Genomics 2020Quote: ... The sample was then combined with 3’ RNA Ligase Master Mix (8μL 50% PEG 8000, 2μL 10x T4 RNA Ligase Buffer (B0216L, NEB), 1.5μL nuclease free water ...
-
bioRxiv - Molecular Biology 2021Quote: ... R: 5’-ccgggaaaaactgaaaaaccattggcacgacaggtttcccgac-3’ from the pKAM555 vector) was inserted at the ClaI site using HiFi assembly (NEB). For the intTEL0 strain creation the pUC19LG plasmid (lacking the PstI(blunted)-BclI fragment of the HARS36 sequence ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA (5 μg) was ligated to the RNA 3’ adaptor using T4 RNA Ligase 2 - truncated (NEB), in the presence of RNase Inhibitor (NEB) ...
-
bioRxiv - Neuroscience 2021Quote: ... Phosphatase treated samples were enzymatically treated for 3 n at 37°C shaking (1.25 μl 10 μM MnCl2, 1.25 μl 20X NEB buffer ...
-
bioRxiv - Genomics 2021Quote: ... Resulting supercoiled plasmid is linearized at the 3’ end of the PolyA tail using BamHI-HF (NEB R3136S), and checked for reaction completion by running on agarose gel ...