Labshake search
Citations for New England Biolabs :
801 - 850 of 1780 citations for 7 chlorobenzo b thiophen 3 2H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... MBTUni-13 primer (5’-ACGCGTGATCAGTAGAAACAAGG-3’) and Phusion Polymerase (NEB M0530L). PCR products were purified with PureLink PCR Purification Kit (Invitrogen K310002 ...
-
bioRxiv - Immunology 2023Quote: ... 3 μL of T4 RNA ligase buffer (NEB, cat. no: M0204S), 1 μL of 10 mM ATP (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 3′-A overhang was added with Klenow fragment (NEB; M0212) and dATP ...
-
bioRxiv - Genomics 2023Quote: ... and 2.5 U Klenow Fragment (3’ -> 5’ exo-) (New England BioLabs) and H2O to 20 μL ...
-
bioRxiv - Genetics 2024Quote: ... and 3 units of Taq DNA Polymerase (New England Biolabs, Inc.) under the following reaction conditions ...
-
bioRxiv - Molecular Biology 2024Quote: ... The fragmented RNA was 3’-end repaired using T4 PNK (NEB) and ligated to RNA adapter (5’-/5rApp/AGATCGGAAGAGCGTCGTG/3SpC3/-3’ ...
-
bioRxiv - Biochemistry 2020Quote: GQES7-a and GQES7-b were synthesized in vitro by transcription (HiScribe™ T7 High Yield RNA Synthesis Kit; New England Biolabs). GQes3 and mutes3 ...
-
bioRxiv - Genomics 2021Quote: ... TF motif libraries in pGL4.10-Sasaki-SS (a) and pCpG-free-EF1α-SS (b) vectors were amplified using standard Illumina Universal and index primers (NEB #E7335S) and sequenced using standard Illumina chemistry ...
-
bioRxiv - Synthetic Biology 2023Quote: ... (fhuA2 [lon] ompT gal (lambda DE3) [dcm] ΔhsdSlambda DE3 = lambda sBamHIo ΔEcoRI-B int::(lacI::PlacUV5::T7 gene1) i21 Δnin5) (New England Biolabs, C2527I) were used ...
-
bioRxiv - Biochemistry 2023Quote: ... XBP1 Part A and Part B were produced by adding a T7 promoter sequence (TAATACGACTCACTATAGGG) and using the HiScribe T7 RNA Synthesis Kit (NEB E2040S). Template DNA was digested by adding DNase I and incubation for 15 min at 37 °C ...
-
bioRxiv - Genetics 2021Quote: ... the poly (A) product was broken into pieces at 94 °C for 5-7 min using the Magnesium RNA Fragmentation Module (NEB, MA, USA). The RNA fragments were then reverse-transcribed using the SuperScript™ II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... The radioactive probes were prepared by end labelling 10 pmoles of DNA oligonucleotide complementary to the sfRNA (Supplementary table 7) with [γ-32P]-ATP (Perkin-Elmer, USA) using T4 polynucleotide kinase (NEB, USA). Unincorporated nucleotides were then removed by gel filtration on Illustra MicroSpin G-25 Columns (GE Healthcare ...
-
bioRxiv - Immunology 2022Quote: ... The PCR enrichment of adaptor-ligated DNA was conducted with 7 cycles and NEBNext® Multiplex Oligos for Illumnina® (NEB, USA) for single end barcoding ...
-
bioRxiv - Microbiology 2020Quote: ... as previously described[7] Phage DNA libraries were prepared using NEBNext Ultra II FS library Prep and Kit for Illumina (New England Biolabs, Ipswich, USA). The sequencing was performed on the Illumina iSeq platform as part of a flowcell (2 x 151 ...
-
bioRxiv - Genomics 2021Quote: ... 1000 ng samples of high quality total RNA (RIN≥ 7) was used for mRNA isolation using NEBNext Ploy(A) mRNA Magnetic Isolation module (New England Biolabs, catalog # E7490), followed by RNA library construction with NEBNext Ultra II Directional Lib Prep (New England Biolabs ...
-
bioRxiv - Immunology 2023Quote: ... PCR was performed with 2 ng of library input per reaction and 7 cycles of amplification using Q5 DNA polymerase (New England Biolabs, catalog # M0491S). Libraries were quantified using a Qubit 4 Fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA was isolated from 50ng of total RNA (RIN value >7) using the NEBNext® Poly(A) mRNA magnetic isolation module, (New England BioLabs, Hitichin, Herts, UK) (NEB, #E7490) and the sequencing libraries were prepared using the NEB® Ultra™ II Directional RNA Library Prep Kit for Illumina® (NEB ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were prepared from 7 ng of RNA per sample using the NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina (NEB, E6420). Libraries were pooled and sequenced using a P3-100 kit from Illumina in a NextSeq2000 sequencer following manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: ... Full-length 265 nt 5’ UTR of SARS-CoV-2 was subcloned to replace the 5’ UTR of human CMV in the pLV-mScarlet vector using a Hifi one-step kit (Gibson Assembly, NEB). Full-length ...
-
bioRxiv - Cell Biology 2019Quote: ... One μg of purified RNA was reverse transcribed into cDNA using the Protoscript II Reverse Transcriptase kit (New England Biolabs). Quantitative real time polymerase chain reactions (qRT-PCR ...
-
bioRxiv - Molecular Biology 2021Quote: ... Full-length 265 nt 5′ UTR of SARS-CoV-2 was subcloned to replace the 5’ UTR of human CMV in the pLV-mScarlet vector using a Hifi one-step kit (Gibson Assembly, NEB). Full-length ...
-
bioRxiv - Microbiology 2021Quote: ... Official CDC SARS-CoV-2 N1 gene primers and TaqMan probe set were used [58] with the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs):
-
bioRxiv - Molecular Biology 2021Quote: ... The mRNA abundance levels were determined using 200 ng total RNA for each sample in technical replicates using Luna Universal One-Step RT-qPCR kit (New England BioLabs) and SYBR Green as detection agent and gene-specific primers (Table S2) ...
-
bioRxiv - Cell Biology 2022Quote: ... and were assembled into pHaloTag-C1 to produce the pHalo-Baf in one-step using the Gibson Assembly Master Mix (New England Biolabs). The cGAS cDNA was amplified by the KOD One from pLPC-cGAS-Flag (Dou et al. ...
-
bioRxiv - Genomics 2020Quote: ... One microgram of DNase-treated total RNA was reverse transcribed using AMV reverse transcriptase (New England Biolabs, Ipswich, MA, USA) and a gene-specific primer for either the germline-limited gene or actin II control ...
-
bioRxiv - Immunology 2021Quote: ... one as Cytosolic Extraction Buffer (CEB) (HEPES 10 mM; KCl 60 mM; EDTA 1 mM; NP40 1%) and another one as Nuclear Extraction Buffer (NEB) (HEPES 20 mM ...
-
bioRxiv - Microbiology 2020Quote: Reverse transcription and amplification for figure 2 was performed using OneTaq One-Step RT-PCR Kit from NEB (cat. # E5315S). Both the OneTaq One-Step RT-PCR Kit and Luna Universal One-step RT-qPCR Kit (cat ...
-
bioRxiv - Microbiology 2019Quote: ... samples were diluted to 5ng/uL and used for qRT-PCR with Luna One-Step Universal qPCR kit (NEB E3005). Gene specific primers for target transcripts were used at a final concentration of 400uM with 15ng of RNA ...
-
bioRxiv - Genomics 2019Quote: ... Ligated RNA was enriched with biotin-labeled products by another round of Streptavidin bead binding and washing (two washes each of High, Binding and Low salt buffers and one wash of 1x Thermo Pol Buffer (NEB)) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and poly(A) RNA was isolated using one round of selection with oligo(dT)25 magnetic beads (New England Biolabs). RNA was then subjected to fragmentation using RNA Fragmentation Reagents (ThermoFisher ...
-
bioRxiv - Pathology 2021Quote: ... β-ENaC/SCNN1B (Hs00165722_m1) and γ-ENaC/SCNN1G (Hs00168918_m1) were performed with the Luna Universal Probe One-Step RT-qPCR Kit (NEB, E3006L). Expression of each gene was normalized to 18S (Hs99999901_s1) ...
-
bioRxiv - Bioengineering 2020Quote: ... was incubated with 2 μΜ biotinylated oligo complementary to one of the two 12 nt cohesive ends in λDNA in T4 DNA ligase reaction buffer (NEB) and hybridized at 70°C for 15 min followed by cooling to 15°C over 2 h ...
-
bioRxiv - Bioengineering 2020Quote: ... We added 1 μL of the resulting DNase digestions to 10 μL RT-qPCR reactions (Luna One-Step Universal RT-qPCR Kit, New England Biolabs) containing 0.8 U/μL RNasin Plus (Promega ...
-
bioRxiv - Bioengineering 2020Quote: ... A HiFi assembly reaction was then performed to join the PCR product with the linear pEERM1 to form the assembled circular plasmid by incubating at 50 °C for one hour using NEBuilder DNA HiFi Assembly Master Mix (New England Biolabs). The HiFi reaction solution (5 μL ...
-
bioRxiv - Bioengineering 2020Quote: ... We performed assays for the E and RNase P genes separately in 20 μL reaction volumes using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs). The final concentrations of primer and probe were 400 and 200 nM ...
-
bioRxiv - Microbiology 2021Quote: ... qRT-PCR was performed from 1µL of template RNA in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 N-specific primers (EV Table 1 ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... PCR was carried out in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 N-specific primers (Forward 5′-TAA TCA GAC AAG GAA CTG ATT A-3′ ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... were amplified in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a QuantStudio 6 Flex thermocycler ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analyses were performed using Luna Universal Probe One-Step qRT-PCR Kit (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: ... RNA was purified using the Macherey Nagel RNA extraction kit following manufacturer’s instruction and viral RNA uptake was quantified using the Luna universal One-Step RT-qPCR kit (NEB; E3005).
-
bioRxiv - Microbiology 2021Quote: ... The three PCR products were assembled as one large fragment (5’ cynX - insert - lacA3’) by Gibson Assembly (New England Biolabs). The assembled DNA was transformed into electrocompetent WT E ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 RNA levels were quantified with 250 ng of RNA inputs using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs), using real-time RT-PCR primer/probe sets 2019-nCoV_N1 (CDCN1 ...
-
bioRxiv - Microbiology 2021Quote: ... PCR was carried out in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 NP-specific primers (Forward 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ ...
-
bioRxiv - Microbiology 2021Quote: ... 4μL purified RNA were subsequently used for RT-qPCR reaction using the Luna Universal One-Step RT-qPCR kit (New England Biolabs) and 0.4μM of each primer ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was subjected to OneStep qRT-PCR analysis using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) and a CFX96 Real-Time System ...
-
bioRxiv - Microbiology 2019Quote: ... Cloning and screening PCR reactions were performed using Q5 High-Fidelity DNA and One-Taq DNA polymerases (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Cell Biology 2021Quote: Intracellular levels of mRNA for TRAP complex subunits were estimated by RT-qPCR using Luna Universal One-Step RT-qPCR Kit (NEB) following total RNA isolation with RNeasy Mini Kit (Qiagen) ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was then diluted to 20 ng/uL and 20-60 ng of RNA was used for qPCR using Luna universal one-step RT-qPCR kit (NEB) as per manufacture’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The Luna Universal One-Step RT-qPCR kit (E3005L) was used for qRT-PCR analysis following the protocol described by the supplier (NEB) by using a CFX96 real-time C1000 thermal cycler (Bio-Rad) ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA copies were quantified in 10% of the obtained eluate volume with a one-step RT-qPCR reaction using a standard curve and the Luna Universal Probe One-Step RT-qPCR kit (New England Biolabs) and previously published TaqMan primers and probe (Corman et al. ...