Labshake search
Citations for New England Biolabs :
801 - 850 of 5521 citations for 7 Bromo 2H 1 3 benzodioxole 5 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... coli 5-alpha cells (NEB). Plasmid DNA from multiple independent clones was isolated for each construct using a Zymo Zyppy 96-well plasmid prep kit ...
-
bioRxiv - Biochemistry 2022Quote: ... 5 ng ET SSB (NEB), 4 nM phi29 DNAP in a 100 μl reaction and incubated for 3 h at 30°C ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 5 μL rCutSmart Buffer (NEB), and 1 μL DpnI (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 nL PEG8000 (50%, NEB) 0.5 nL BSA (20ng/ml ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 nL PEG8000 (50%, NEB), 1.2 nL BSA 20 ng/ml (NEB) ...
-
bioRxiv - Microbiology 2023Quote: ... coli 5-alpha cells (NEB) following manufacturer’s recommendations and selected by plating on LB in the presence of appropriate antibiotics ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µL RppH (NEB #M0356S). Decapped RNA was cleaned using Zymo Oligo clean and concentrator kit (Zymo Research #D0460 ...
-
bioRxiv - Microbiology 2023Quote: ... and 5’-deadenylase (NEB M0331S) treatments ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5’ deadenylase (NEB, M0331) for 30min at 30°C followed by column purification (Zymo research ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli NEB 5-alpha (NEB) was used for standard cloning of other plasmids ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 U BbsI (NEB, R0539L) and nuclease-free water for a total of 5 µl reaction mix ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli NEB 5-alpha (NEB) and otherwise followed the manufacturers recommended protocol ...
-
bioRxiv - Genetics 2023Quote: ... 5 units of HindIII (NEB), 4.13 µL of H2O ...
-
bioRxiv - Genetics 2023Quote: ... 5 units of HindIII (NEB), and 6.33 uL of purified DNA ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 U BsaI-HFv2 (NEB), 250 U T4 DNA ligase (2,000,000 U/ml ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-decapping (RppH, M0356S; NEB) and 5′-hydroxyl group repair (T4 polynucleotide kinase (M0201L ...
-
bioRxiv - Molecular Biology 2023Quote: ... NcoI- HF (NEB, 5 U) or Rad50/Mre11 (125 nM final tetramer ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Lachnospiraceae bacterium Cpf1 (LbCpf1) (200 nM) were independently preincubated with sgRNA (600 nM) in cleavage buffer [1× NEBuffer 3 (New England Biolabs, Ipswich, MA), 10 mM DTT ...
-
bioRxiv - Neuroscience 2021Quote: ... Enzyme restriction with DpnII was performed in 30 µl reaction mix (1 µl DpnII, 3 µl DpnII buffer, 10 µl purified DNA and 16 µl H2O; New England Biolabs, Ipswich, MA) and incubation at 37°C for 2h ...
-
bioRxiv - Genomics 2021Quote: ... nascent RNA samples were processed through the following steps: (i) 3′ adapter ligation with T4 RNA Ligase 1 (NEB, Ipswich, MA; M0204), (ii ...
-
bioRxiv - Cell Biology 2020Quote: ... primers 1 - 3) and then inserting the resulting PCR product into BamHI-digested pBMN-mCherry using Gibson assembly (New England Biolabs, Ipswich, MA). The resulting pBMN-ARHGAP36-mCherry vectors with XhoI and SacII restriction sites were subsequently used in all experiments described herein.
-
bioRxiv - Molecular Biology 2020Quote: ... and 0.1% Tween) with 3% BSA and then incubating the strips in 1:2000 dilution of monoclonal anti-MPB-HRP antibody (NEB, Inc, USA) in a blocking buffer for 1 h at room temperature ...
-
bioRxiv - Biophysics 2021Quote: ... was annealed with primer P3 (100 bp long) at a 1:3 DNA to primer molar ratio and ligated using T4 DNA ligase (NEB, catalog #M0202S). Primer P3 had biotin modification at its 3’ end ...
-
bioRxiv - Genomics 2022Quote: ... RNA samples were then processed through the following steps: (i) 3′ adapter ligation with T4 RNA Ligase 1 (NEB, Ipswich, MA; M0204), (ii ...
-
bioRxiv - Immunology 2023Quote: ... using primers that overlapped with pLenti-EF1-Blast at the xho1 site on the 5’ end and overlapped with the 5’-end of the RNase L coding sequence on the 3’-end (Supplementary table 1) and NEBNext® High-Fidelity 2X PCR Master Mix (New England Biolabs: M0541S). RNase L coding sequence was amplified using a 3’-end primer that overlapped with pLenti-EF1-Blast at the xba1 site ...
-
bioRxiv - Cancer Biology 2023Quote: ... The purified shESR1 and SGEN DNA were digested with XhoI and EcoRI and subsequently ligated at a molar ratio of approximately 3:1 with 10X T4 DNA Ligase Buffer (New England BioLabs Inc. #B0202S) and T4 DNA Ligase (New England BioLabs Inc ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 µl 10 x dNTPs with dUTP instead of dTTP (2 mM each) and 1 µl T4 polymerase (NEB) were added and the mixture was incubated at 37°C in a thermal cycler for 20 min ...
-
bioRxiv - Biochemistry 2021Quote: ... 2.5 μl of reaction was added to a tube containing 5 μl replication buffer and 1 μl MseI (NEB) for 3 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... Ncas_Int679_For 5′ GGCAAATTTGTATGAGGGATAAA and Ncas_Int679_Rev 5′ TAATTCGATTACGTTAGCTGTT) and cloned into pRS403-pGAL1-hpSC_URA3 (1) using PsiI and NaeI restriction enzymes (New England Biolabs, NEB). In addition ...
-
bioRxiv - Cell Biology 2021Quote: ... COS-7 cell lysates from FLAG-ACBD4(wACBD5_FFAT)/5 (mFFAT) expressing cells were treated for 1 h with λPP (New England BioLabs) as described above ...
-
bioRxiv - Biochemistry 2020Quote: Every single stranded oligonucleotide (1 nmol) was 5’-end-phosphorylated with 40U of T4 Polynucleotide kinase (New England Biolabs) by incubation at 37°C in 1x T4 DNA Ligase Reaction Buffer.
-
bioRxiv - Microbiology 2020Quote: ... 0.5 μM of each forward and reverse primer (Supplementary Table 1) and 2.5 U Long Amp Taq Polymerase (NEB) in a total volume of 25 μL ...
-
bioRxiv - Genomics 2020Quote: ... Capture plate wells contained 5 µl of capture solution (1:500 Phusion High-Fidelity Reaction Buffer, New England Biolabs; 1:250 RnaseOUT Ribonuclease Inhibitor ...
-
bioRxiv - Genetics 2022Quote: ... 1 µL of extracted genomic DNAs and 5 µL of 2× Hot Start High Fidelity Q5 Master Mix (NEB). PCR reactions were carried out under the following condition ...
-
bioRxiv - Cell Biology 2022Quote: ... the fragment and vector were mixed in a 5:1 ratio and ligated with T4 DNA Ligase (NEB, M0202L) overnight at 16°C ...
-
bioRxiv - Immunology 2023Quote: ... were single-cell sorted into 5 µl 1% (v/v) Nonidet P40 Substitute, Tris-HCl (20 mM, pH 8.0) containing 5 U murine RNase inhibitor (NEB) using a FACSAriaIII instrument (BD) ...
-
bioRxiv - Molecular Biology 2023Quote: ... To obtain dephosphorylated TOP2B used for in vitro kinase assay and mass spectrometry the YFP column incubated twice for 15 min at room temperature in wash buffer supplemented with 0.1mM MnCl2 and 5 units mL-1 calf intestinal phosphatase (NEB), 400 units mL-1 lambda protein phosphatase (NEB) ...
-
bioRxiv - Developmental Biology 2023Quote: ... After centrifugation the EtOH-precipitated fragments were resuspended in water and ligated to 0.25 µM randomized 5’ RNA adapter using T4 RNA ligase 1 (NEB) in the same buffer conditions as described above ...
-
bioRxiv - Molecular Biology 2023Quote: NCBP1-NCBP2 at 1.2 μM was incubated with mALYREF2 (residues 1-155) at 3.6 μM in the presence of the 5’ cap analog m7GpppG (NEB) at 500 μM at 4 °C for 0.5 hr ...
-
Atypical epigenetic and small RNA control of transposons in clonally reproducing Spirodela polyrhizabioRxiv - Plant Biology 2024Quote: ... The elution was then ligated to 5′ barcoded RNA adapters using T4 RNA ligase 1 (New England Biolabs, #M0204). To reduce ligation biases ...
-
bioRxiv - Molecular Biology 2023Quote: ... A 5′ adapter (rArCrArCrUrCrUrUrUrCrCrCrUrArCrArCrGrArCrGrCrUrCrUrUrCrCrGrArUrCrU, IDT) was then ligated to RNAs to the product using T4 RNA ligase 1 (NEB) for 4 hours at 15°C ...
-
bioRxiv - Genomics 2019Quote: ... 300 ng of purified genomic DNA was nicked with 7 U nicking endonuclease Nt.BspQI (New England BioLabs, NEB) at 37°C for two hours in NEB Buffer 3.1 ...
-
bioRxiv - Genomics 2019Quote: ... 300 ng of purified genomic DNA was nicked with 7 U nicking endonuclease Nt.BspQI (New England BioLabs, NEB) at 37°C for two hours in NEB Buffer 3.1 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... End repair was performed by adding 20 μl of the End Repair Mix (7 μl of 10x NEB ligation buffer ...
-
bioRxiv - Genomics 2019Quote: ... 300 ng of purified genomic DNA was nicked with 7 U nicking endonuclease Nb.BbvCI (NEB, Ipswich, MA, USA) at 37°C for two hours in NEB Buffer 2 ...
-
bioRxiv - Genomics 2019Quote: ... 300 ng of purified genomic DNA was nicked with 7 U nicking endonuclease Nt.BspQI (New England BioLabs (NEB), #R0644 ...
-
bioRxiv - Genomics 2019Quote: ... 300 ng of purified genomic DNA was nicked with 7 U nicking endonuclease Nt.BspQI (New England BioLabs (NEB), #R0644 ...
-
bioRxiv - Genomics 2023Quote: ... Gaps in the transposed DNA were filled by 15μL gap-fill mix (7 μL Q5 reaction buffer (NEB), 7 μL Q5 high GC enhancer (NEB) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3 µl Hind III (Fisher, FD0504), 3 µl EcoRI (Fisher, FD0274), and 3 µl Bam HI (Fisher, FD0054) in RNase H buffer (NEB, M0297) overnight at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: 5’ Phosphorylated RA3 oligonucleotides were adenylated using 5’ DNA Adenylation Kit (New England BioLabs E2610S), by mixing 1 μL of 100 μM of 5’ Phosphorylated RA3 ...