Labshake search
Citations for New England Biolabs :
801 - 850 of 4422 citations for 6 Fluoro 1 3 benzodioxene 8 carbonyl chloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... was also reverse-transcribed and Illumina sequencing library prep was followed by 8–10 cycles of polymerase chain reaction (PCR) using High Fidelity Phusion (New England Biolabs). All the libraries were barcoded in the PCR step ...
-
bioRxiv - Cancer Biology 2023Quote: ... Amplification with barcoded primers was performed with a few numbers of PCR cycles (5 to 8) and a high-fidelity polymerase (Q5, NEB). Amplified libraries were size-selected on a non-denaturing 8% acrylamide gel and purified ...
-
bioRxiv - Genomics 2023Quote: ... Samples were diluted in 8 ml of T4 DNA ligase buffer 1X and incubated 8 hours at 16°C with 8000 Units of T4 DNA ligase (NEB). Crosslinks were reversed overnight at 60°C in the presence of proteinase K (0.125 mg / ml final ...
-
bioRxiv - Systems Biology 2023Quote: ... Each library was dissolved in 100µL Tris 10mM pH 8 and amplified by PCR with specific primers (Fw: GTGAACCGTCAGATCGCCTCGGCACTCCAGTCCT, Rv: AGAGGGTTAGGGATAGGCTTACCTCAGGCTAGTGCGGACCGAGTCG) using NEBNext Ultra II Q5 HotStart (NEB). PCR cycling parameters were set as follows ...
-
bioRxiv - Genomics 2024Quote: ... dATP (3x 1.5 µL of 10 mM solutions) and 8 µL of 5 U/µl Klenow fragment of DNA polymerase I (New England Biolabs) and a 30-minute incubation at 37°C with rotation ...
-
bioRxiv - Genomics 2024Quote: ... Genomic DNA was harvested by discarding culture media and adding lysis buffer consisting of 20 mM Tris pH 8 and 0.1% Triton X-100 (MilliporeSigma T9284) with 60 ng/mL of Proteinase K (New England Biolabs P8107S) added immediately prior to use ...
-
Bio-orthogonal Glycan Imaging of Culture Cells and Whole Animal C. elegans with Expansion MicroscopybioRxiv - Bioengineering 2024Quote: ... Recombinant Muc1 or lubricin mixed with one of the following enzymes: 8 unit/mL of proteinase K (P8107S, New England Biolabs), 500 μg/mL of pronase (10165921001 ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were diluted in 8 ml of T4 DNA ligase buffer 1X and incubated 8 hours at 16°C with 8000 Units of T4 DNA ligase (NEB). Crosslinks were reversed overnight at 60°C in the presence of proteinase K (0.125 mg / ml final ...
-
bioRxiv - Genomics 2023Quote: ... The resulting digested DNA (4 ml in total) was divided into four aliquots and diluted in 8 ml of ligation buffer (1X ligation buffer NEB without ATP ...
-
bioRxiv - Molecular Biology 2020Quote: ... 20 ng of DNA was digested with 6 to 12 U of the restriction enzyme PvuII (NEB) overnight at 37°C.
-
bioRxiv - Genomics 2020Quote: ... DNA libraries were amplified by PCR for 6-10 cycles with Phusion HF DNA Polymearse (NEB, M0530) using Illumina TruSeq indexing primers for multiplexing ...
-
bioRxiv - Cell Biology 2020Quote: ... Images were collected every 10 mins for up to 6 days and the timing of events (NEB, the start of cytokinetic furrow ingression and the appearance of 2 distinct cells ...
-
bioRxiv - Microbiology 2019Quote: ... the product was cloned into the pET1-5b N-terminal 6×His expression plasmid (New England Biolabs).
-
bioRxiv - Microbiology 2023Quote: ... Desialylation of Calu-3 cells was achieved by incubating cells grown in a 96 well plate or 24-well plate or 6 well plate with 100 U/mL α2-3,6,8,9 neuraminidase A (P0722L, NEB) in 10% FCS media for 3 h at 37°C ...
-
bioRxiv - Biochemistry 2022Quote: ... reactions were performed with 6 μl of PURExpress ΔRF123 in vitro protein synthesis system (New England Biolabs) in the presence of 1x RF3 ...
-
bioRxiv - Biophysics 2023Quote: ... and the DNA of the SL5-6 domains was then digested using BsaI (New England Biolabs #R0535) followed by Mung Bean Nuclease (New England Biolabs #M0250) ...
-
bioRxiv - Cell Biology 2020Quote: 3′ linker ligation (1x PNK buffer, 20 U T4 RNA ligase I (NEB), 20 U T4 RNA Ligase II truncated K227R ...
-
bioRxiv - Cell Biology 2020Quote: ... the old H4-SNAP pool was first quenched with 3 μM BTP (NEB) for 30 min in complete medium ...
-
bioRxiv - Genomics 2020Quote: ... and 3 μL of Uracil-Specific Excision Reagent (USER) Enzyme (NEB, Beijing, China) was then used with the size-selected and adaptor-ligated cDNA at 37°C for 15 min ...
-
bioRxiv - Systems Biology 2022Quote: ... total RNA was first ligated to adaptors at the 3’ end by NEB 3’ SR adaptor and 5’ end by T4 RNA ligase followed by reverse transcription into cDNA using M-MuLV Reverse Transcriptase ...
-
bioRxiv - Immunology 2022Quote: ... plates were washed 3 times with PBS-T and TMB substrate (Denovo Biolabs) was added for development of color ...
-
bioRxiv - Genomics 2020Quote: ... 4 μL of 3 U/μL NEB T4 DNA Polymerase (New England Biolabs), 1 μL of 5U/μL Klenow (New England Biolabs) ...
-
bioRxiv - Genomics 2019Quote: ... The mixture was supplemented with 5 µL DNA polymerase (3 U/µL, NEB) and 6 µL Klenow (5 U/µL ...
-
bioRxiv - Genetics 2020Quote: ... 3 µl of dNTPs (2.5 mM each) and 5 U Klenow exo- (NEB) and incubating for 1 h at 30°C ...
-
bioRxiv - Biochemistry 2021Quote: 100 μl extension reactions were performed with Klenow Fragment (3’→5’ exo-) (NEB) (Figures 2B ...
-
bioRxiv - Biophysics 2021Quote: ... where GRN-3 was expressed in Escherichia coli SHuffle cells (New England Biolabs) while other GRNs were expressed in Origami 2 DE3 cells (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... The reaction was supplemented with 3 μl of T4 RNA ligase I (NEB), 1.5 μl of 10X reaction buffer ...
-
bioRxiv - Biophysics 2021Quote: ... and poly(A)-tailed at their 3’ ends with poly(A) polymerase (NEB), following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... then perform A-tailing with Klenow Fragment (3’-> 5’ exo-) (NEB, Cat. M0212S) provided with dATP ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was removed 3’phosphoryl groups using T4 Polynucleotide Kinase (New England Biolabs) in the buffer (70 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 ng of DNA was used per qPCR reaction (qPCR Master Mix, NEB). PCR was performed using an Applied Biosystems 7500 instrument (software version 2.3) ...
-
bioRxiv - Genomics 2019Quote: ... and 3 µl of NEBNext Ultra II End Prep Enzyme Mix (E7545L, NEB) were mixed gently in 1.5 ml Eppendorf tube ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ phosphorylation and 3’ dephosphorylation were performed with T4 PNK (NEB, Cat: M0201S) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and A-tailed using Klenow 3’-5’exo-enzyme (NEB, Cat. No. M0212). Illumina sequencing library adapters were subsequently ligated to DNA ends ...
-
Glucocorticoid receptor collaborates with pioneer factors and AP-1 to execute genome-wide regulationbioRxiv - Genomics 2021Quote: ... In-line barcoded 3′ adapters were ligated with T4 RNA ligase I (NEB) for 12 hours at 20°C ...
-
bioRxiv - Genomics 2022Quote: ... and 3’-adenylated with NEBNext Ultra II End Repair/dA-Tailing Module (NEB). The DNA was then purified with AMPure XP beads (Beckmann Coulter ...
-
bioRxiv - Molecular Biology 2022Quote: ... pUC19-3’ITR-3xCTCF- rHA was linearized with KpnI and HindIII (NEB, R3104L) and the Neomycin resistance gene was amplified from pEN113 (Addgene ...
-
bioRxiv - Genomics 2022Quote: ... and 3 µL 5U/µL DNA Polymerase I Large (Klenow) Fragment (NEB, #M0210V) was added and incubated at 37°C for 45min with rotation ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 mM MgCl2 and 2 μL (10 U) RNase H (NEB, Cat# M0297S) in order to digest poly(A ...
-
bioRxiv - Molecular Biology 2022Quote: ... Next the 3’ primer regions were truncated using the BciVI restriction endonuclease (NEB), followed by 2.0x AMPure XP cleanup ...
-
bioRxiv - Molecular Biology 2023Quote: Hi-C libraries were treated with 3 U of T4 DNA polymerase (NEB) in the presence of 0.1 mM dGTP (NEB ...
-
bioRxiv - Genomics 2023Quote: ... and A-tailed with Klenow Fragment (3’-to-5’ exo-, New Englands Biolabs) following manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... mRNA was radiolabelled at the 3’ end using T4 RNA ligase I (NEB) and [32P] pCp (Perkin Elmer ...
-
bioRxiv - Cell Biology 2023Quote: ... which were then degraded by the 5’-3’ ssDNA exonuclease RecJ (NEB, M0264S). After rRNA reduction using the riboPOOL rRNA depletion kit (siTOOLs Biotech ...
-
bioRxiv - Genomics 2023Quote: ... Nicked DNA was then extended with 3 U of Vent (exo-) Polymerase (NEB), 100-300 µM dNTPs ...
-
bioRxiv - Genetics 2024Quote: ... the slides were treated with 3 U/µl exonuclease III (New England Biolabs) in 1x NEB cutsmart buffer and incubated at 37°C for 15 min to digest nicked BrdU-positive strands ...
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA was then ligated to adaptors at the 3’ end by NEB 3’ SR adaptor and 5’ end by T4 RNA ligase ...
-
bioRxiv - Evolutionary Biology 2021Quote: Reverse transcription was performed by adding the following to the above reaction: 8 uL of 5x first strand buffer (NEB E7330L), 2 uL of 10mM dNTPs (each) ...
-
bioRxiv - Biochemistry 2020Quote: ... and 8 pmol of purified DNA was then used for in vitro transcription with T7 RNA polymerase (New England Biolabs Inc.). The resulting RNA was purified with Agencourt RNAClean XP beads supplemented with an additional 12% of PEG-8000 (3 volumes of 40% PEG-8000 was added to 7 volumes Agencourt RNAClean XP beads ...
-
bioRxiv - Biochemistry 2021Quote: ... libraries were generated using 5 μl of the purified RT reaction product and 4-8 cycles of PCR with Q5 high fidelity polymerase (NEB, M0491S). PCR reaction products were column purified ...