Labshake search
Citations for New England Biolabs :
801 - 850 of 2947 citations for 3 3 17 17 Bis ethylenedioxy 19 hydroxyandrost 5 ene 19 d2 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... followed by 23.5 μl of ligation mix (3 μl 1x T4 ligase buffer (NEB, B0202S), 0.15 μl 50 mg/ml BSA (ThermoFisher Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... and 2,000 nM Rad51 were incubated with 3 μM nt ϕX174 ssDNA (5,386 nt; NEB) in buffer containing 2 mM nucleotide (where indicated) ...
-
bioRxiv - Molecular Biology 2024Quote: ... A second adapter was then ligated to the 3’OH of the cDNAs (with NEB HC RNA Ligase in NEB ligation buffer plus 5% DMSO ...
-
bioRxiv - Microbiology 2024Quote: ... The 3 fragments were assembled using Gibson assembly (NEBuilder HiFi DNA Assembly Master Mix, NEB). To re-introduce the proBA operon (now with A319G ...
-
bioRxiv - Neuroscience 2024Quote: The 3 DNA fragments were fused using the Gibson Assembly Cloning kit (New England Biolabs) and subcloned into the pCR2.1-TOPO vector (Invitrogen) ...
-
bioRxiv - Systems Biology 2024Quote: ... and NEBNext Multiplex Oligos for Illumina Index Primers Set 1 and 3 (NEB E7335S, E7710S) and PCR-amplified for 15 cycles ...
-
bioRxiv - Molecular Biology 2024Quote: The biotin-enriched eluate was next subjected to 3’end dephosphorylation using PNK (M0201L, NEB) and FastAP (EF0654 ...
-
bioRxiv - Genomics 2024Quote: ... the 3’ end of RNA fragments was dephosphorylated with FastAP (Thermo) and T4 PNK (NEB), followed by 5’ end phosphorylation of cleaved target RNAs with T4 polynucleotide kinase (PNK ...
-
bioRxiv - Developmental Biology 2024Quote: ... custom NTP mix was prepared with 3’-O-Me-m7G cap analogue (60 mM, NEB), GTP (75mM ...
-
bioRxiv - Genomics 2024Quote: ... to 3’-P presenting in the RNA that was dephosphorylated using T4 PNK (NEB, #M0201S). Linker and RNA ligation was performed by ligating pre-adenylated linker to the 3’-OH of RNA using RNA ligase2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... or a polyclonal rabbit antibody against cleaved casp-3 (1:100; New England Biolabs, Frankfurt, Germany), followed by a biotinylated goat anti-rabbit secondary antibody (Abcam ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3 µl were used for amplification with Taq 2X Master Mix (New England Biolabs, Ipswitch, USA) using a 20-cycles PCR protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Products were then ligated to 3’ adaptor (/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/) by T4 RNA ligase 2(NEB) and 5’ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCr-GrArCrGrArUrCrNrNrNrCrGrArNrNrNrUrArCrNrNrN ...
-
bioRxiv - Physiology 2021Quote: ... RNA 3’ end dephosphorylation reaction consisted of T4 PNK (20 U/10 μL sample, NEB M0201S), SuperaseIn in 1X T4 PNK buffer without ATP for 60 min at 37 °C ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA from A549 cells (3 µg in 30 µl) was treated with RppH (NEB M0356) at 30 °C for 1 hr and purified by spin column ...
-
bioRxiv - Genomics 2020Quote: ... Fragmented RNAs were then dephosphorylated at their 3’ end using PNK (New England Biolabs, Cat: M0201) in MES buffer (100 mM MES-NaOH ...
-
bioRxiv - Biochemistry 2021Quote: ... Table 3) region of clpP1 was amplified by PCR (GC buffer, Phusion polymerase, New England Biolabs) using isolated L ...
-
bioRxiv - Biochemistry 2020Quote: ... Desalted peptides were dissolved at a concentration of 3 µg/µL in 1x CutSmart buffer (NEB, 50 mM potassium acetate ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Vcan exon 2 and exon 3 were amplified using Phusion Taq (NEB, catalog no. F530L) (see SI) ...
-
bioRxiv - Biophysics 2021Quote: Purified plasmids were digested at the 3’ end of the insert sequence with EcoRI-HF (NEB) to linearize the template with a 5’ overhang for in vitro transcription ...
-
bioRxiv - Genomics 2022Quote: ... 3 ug of input DNA was dephosphorylated with Quick CIP (New England Biolabs, cat no M0508). Following enzyme inactivation with alkaline phosphatase ...
-
bioRxiv - Bioengineering 2022Quote: ... NU-1707L) was added to the probes’ 3’ ends with Terminal Transferase (New England Biolabs, M0315L), which adds a single azido-dATP molecule ...
-
bioRxiv - Developmental Biology 2022Quote: ... Ribosome footprints were generated by incubating the lysate with 3 U/µg of micrococcal nuclease (NEB) for 40 min at 25° C ...
-
bioRxiv - Developmental Biology 2020Quote: ... The bcd-3’UTR was PCR amplified using Q5 high-fidelity polymerase (New England Biolabs, M0491S) from genomic DNA using the primers 5’-GAGTCATCA-TCATCAGTTTCGTCAAAAGTAACCTGGATGAGAGGCGTGTTAGAG-3’ and 5’-CTGGGTCG-GCGCGCCCACCCTTGTCTAGGTAGTTAGTCACAATTTACCCGAGTAGAGTAG-3’ ...
-
bioRxiv - Biochemistry 2021Quote: ... rinsed with PBS and incubated in PBS containing 3% molecular biology grade BSA (New England Biolabs) and 0.05% Tween-20 for 1 h at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... Then the piggy-bac vector pPBhCMV1-miR(BsgI)-pA-3 was digested with BsgI (#R05559S, NEB) and the digested vector excised from a DNA agarose gel and the DNA purified ...
-
bioRxiv - Genomics 2021Quote: ... dATP was added to the 3’ ends by adding 9μL of A-tailing mix (5μL NEB buffer 2.1 ...
-
bioRxiv - Genomics 2021Quote: dATP was added to the 3’ ends by adding 9μL of A-tailing mix (5μL NEB buffer 2.1 ...
-
bioRxiv - Genomics 2021Quote: ... followed by an overnight incubation at 16°C with 3 µL T4 DNA ligase (NEB, M0202). Samples were purified with phenol-chloroform and used as 3C templates for Taqman-qPCR ...
-
bioRxiv - Biochemistry 2021Quote: ... Concentrated medium was collected from the filters and 3 μl of PNGase F (New England Biolabs) was added to each sample then incubated at 37 °C for 24 h ...
-
bioRxiv - Biochemistry 2021Quote: ... media was replaced with media containing 3 µM SNAP-Cell block (New England BioLabs cat. # S9106S) and cells maintained at 37 °C ...
-
bioRxiv - Biochemistry 2021Quote: ... Table 3) region of clpP1 was amplified by PCR (GC buffer, Phusion polymerase, New England Biolabs) using isolated L ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3′ dA-tailed using NEBNext® Ultra™ II End Repair/dA-Tailing Module (NEB E7546L) and were purified with paramagnetic beads ...
-
bioRxiv - Cancer Biology 2020Quote: ... Positive control slides were treated with 3 U/mL DNase-1 (New England Biolabs, Cat. M0303) for 10 minutes at room temperature ...
-
bioRxiv - Plant Biology 2022Quote: ... and a NEBNext Multiplex Oligos for Illumina (Index Primers Set 3) (Code E7710; New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... denatured and phosphorylated with 10 U of 3’-phosphatase-minus T4 polynucleotides kinase (New England Biolabs) at 37 °C for 30 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... and ligated to the 3′ adapter by incubating with T4 RNA ligase 2 truncated mutant (NEB) and 1 µg of pre-adenylated adapter (5′rAppCTGTAGGCACCATCAAT/3ddc ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... A deoxyadenosine triphosphate was added at each 3’end with the Klenow fragment (New England Biolabs), and (3 ...
-
bioRxiv - Molecular Biology 2024Quote: ... About 3 µg of DNA from each sample was digested with two restriction enzymes (PstI; NEB catalog #R0140 and XhoI ...
-
bioRxiv - Cell Biology 2024Quote: ... newly deposited CENP-A was labelled with 3 µM SNAP-Cell® 647-siR (S910102S, NEB) for 30 mins before washing excess with media and allowing to grow for a further 30 mins ...
-
bioRxiv - Genomics 2024Quote: ... and pooled into 7 ml ligation buffer (1X ligation buffer 3 (New England Biolabs; without ATP), 1 mM ATP ...
-
bioRxiv - Bioengineering 2024Quote: ... The extracted DNA (3 μg) was fully digested with NcoI restriction enzyme (New England Biolabs, USA), separated in a 0.8% agarose gel and blotted onto a Hybond+ Nylon membrane (Amersham Biosciences) ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 μg of total RNA was reverse transcribed using LunaScript cDNA Synthesis Kit (New England Biolabs). Gene-expression levels were quantified by real-time quantitative PCR (iCycler iQ BioRad ...
-
bioRxiv - Biochemistry 2023Quote: ... The tRNA 2’-3’ cyclic phosphate was removed by treatment with T4 PNK (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3-4 μg of sperm gDNA was dephosphorylated with 10 μl of rSAP (NEB, no. M0371S) and 16 μl of 10× rCutSmart buffer (NEB ...
-
bioRxiv - Genetics 2023Quote: ... then dATP was added to the 3′ ends of the DNA using Klenow exo-(NEB #M0212). The DNA was then subjected to double-sided SPRI bead size selection (AMPure XP beads ...
-
bioRxiv - Microbiology 2023Quote: ... Pre-adenylated L3-1R-App 3’ adaptors were ligated using T4 RNA ligase 1 (M0204, NEB) for 75 min at 25°C ...
-
bioRxiv - Biochemistry 2024Quote: ... the RNA was ligated to the 3′ adaptor tRNA using T4 RNA ligase 2 (NEB, M0351L) for 2 h at 37°C ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 3% dimethyl sulphoxide (DMSO) and 0.4 U of Taq-Phusion High-Fidelity (New England Biolabs, USA). PCR conditions were as follows ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The 3′ end of isolated RNA was subsequently dephosphorylated using T4 polynucleotide kinase (New England Biolabs) at 37 °C for 1 hour based on the manufacturer’s protocol ...