Labshake search
Citations for New England Biolabs :
801 - 850 of 10000+ citations for 2 Arachidonoylglycerol 2 AG CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... PCRs were performed with Phusion High-Fidelity DNA Polymerase (2 U/µL) (New England Biolabs) in a total volume of 50 μl ...
-
bioRxiv - Genomics 2020Quote: ... 5 μL of Phusion High Fidelity 2× Master mix (New England Biolabs, Beverly MA, USA) and 2 μL of 10 μM standard Illumina P1 and P2 primers ...
-
bioRxiv - Bioengineering 2020Quote: ... PCR was performed using Q5® High-Fidelity 2× Master Mix (New England Biolabs, US). The point mutation in dCas9 to create H840A Cas9n was made using Q5® Site-Directed Mutagenesis Kit (New England Biolabs ...
-
bioRxiv - Bioengineering 2020Quote: ... or colony PCR using Q5® High-Fidelity 2× Master Mix (New England Biolabs, US) if a chromosomal region was targeted ...
-
bioRxiv - Biochemistry 2021Quote: ... The sample was then resuspended in 100 μl/sample volume of 1X NEBuffer 2 (NEB) supplemented with Triton X-100 to 0.1% and transferred to a new tube ...
-
bioRxiv - Cancer Biology 2021Quote: ... were incubated at 37 °C for 2 hours in 1x T4 DNA ligase buffer (NEB). Following this incubation 1200 units T4 DNA ligase (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... Genomic DNA (2 μg) was digested with the AluI restriction enzyme (New England Biolabs, U.S.A) and purified by using an illustra GFX PCR DNA and Gel Band Purification Kit (GE Healthcare ...
-
Cellular and structural basis of synthesis of the unique intermediate dehydro-F420-0 in mycobacteriabioRxiv - Biochemistry 2020Quote: ... For Southern blotting analysis 2 μg of gDNA was digested with appropriate restriction enzymes (NEB) at 37 °C for 16 hours ...
-
bioRxiv - Neuroscience 2020Quote: ... 1μL DNase I and 2 μL 10x DNase buffer (New England Biolabs, Ipswich, MA, USA), and incubated for 30 min at 37°C ...
-
bioRxiv - Biochemistry 2022Quote: ... Mif2 was treated for 2 h at 30 °C with lambda-phosphatase (New England Biolabs) according to the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2020Quote: ... and ligation at room temperature for 2 hours using T4 DNA ligase (New England Biolabs). The ligation product was transformed into E ...
-
bioRxiv - Microbiology 2020Quote: ... and ligated for 2 hours at room temperature using T4 DNA ligase (New England Biolabs). The ligation product was transformed into E ...
-
bioRxiv - Molecular Biology 2020Quote: ... preadenylated) was ligated to the RNA using T4 RNA ligase 2 truncated (New England Biolabs) by incubating at 25°C for 6 hr ...
-
bioRxiv - Microbiology 2021Quote: ... primers MR161 and MR162 (Table 2) were phosphorylated with T4 Polynucleotide Kinase (New England Biolabs) at 37°C for 1 h in a 4.5 μl reaction volume with 10 μM primer ...
-
bioRxiv - Immunology 2020Quote: ... to generate Cap 0 and in some cases also the Vaccinia 2’ O methyltransferase (NEB) to generate Cap 1 ...
-
bioRxiv - Genomics 2022Quote: ... Each PCR#2 reaction contained 25 µL of Q5 High-Fidelity 2X Master Mix (NEB), 2.5 µL of a unique Nuc PCR#2 Fwd Primer (10 µM) ...
-
bioRxiv - Immunology 2022Quote: PCRs were done with the Q5 Hot-start 2× master mix (New England BioLabs, NEB), and cloning was performed using the Gibson Assembly 2× Master Mix (NEB ...
-
bioRxiv - Immunology 2022Quote: PCRs were done with the Q5 Hot-start 2× master mix (New England BioLabs, NEB), and cloning was performed using the Gibson Assembly 2× Master Mix (NEB ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 5 μl of the resulting amplicon were diluted 1:4 in 1x buffer 2 (NEB), followed by denaturation and re-annealing in a nexus GSX1 Mastercycler (Eppendorf ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was removed by adding 2 μL DNaseI and 5 μL 10x DNase buffer (NEB) to the purified RNA and incubated at 37C for 30 minutes ...
-
bioRxiv - Bioengineering 2019Quote: ... LAMP mix contained 10 µL 2×WarmStart LAMP Mastermix (New England Biolabs, Ipswich, MA, USA) and 6 µL water ...
-
bioRxiv - Cancer Biology 2021Quote: ... for 1 h followed by incubating with 2 μL Proteinase K (New England Biolabs, USA) at 65 °C ...
-
bioRxiv - Bioengineering 2021Quote: ... The sample was chilled to halt the denaturation process and GlycoBuffer 2 (New England Biolabs), NP-40 ...
-
bioRxiv - Molecular Biology 2020Quote: 3’ linker ligation (1x PNK buffer, 800 u T4 RNA ligase 2 truncated KQ (NEB), 80 u RNaseOUT ...
-
bioRxiv - Biochemistry 2021Quote: ... recombinant SARS-CoV-2 Omicron RBD was digested with EndoH over night (New England Biolabs). Recombinant hACE2 protein was digested using EndoH (New England Biolabs ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 ug of DNA was treated with uracil DNA glycosylase (UDG, New England Biolabs, Inc.) for 60 minutes at 37°C with gentle shaking ...
-
bioRxiv - Genomics 2022Quote: ... and NEBNext Multiplex Oligos for Illumina Index Primers Sets 1 and 2 (NEB E7335S & E7500S). In order to increase input DNA above single library limits (1 μg ...
-
bioRxiv - Microbiology 2023Quote: ... a fragment including the SARS-CoV-2 RdRp catalytic residue was subcloned into pUC19 (NEB) and the resulting pUC19-RdRp was mutated at the RdRp catalytic residue by inverse PCR using mutation-introducing primers (Supplementary Table 1) ...
-
bioRxiv - Microbiology 2022Quote: ... PCR amplicons encompassing exon 2 of SERINC3 were produced using Taq 2x Master Mix (NEB) and the following primers ...
-
bioRxiv - Cell Biology 2023Quote: ... The cutting vector GW223_pX330A_sgX_sgPITCh (2 μg) was digested with BbsI-HF (New England Biolabs; #R3539) in Cutsmart Buffer (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... For AsiSI digestion, samples were equilibrated (2 min, RT) in 150 µL CutSmart buffer (NEB). 3µl recombinant AsiSI endonuclease (10U/µL ...
-
bioRxiv - Molecular Biology 2023Quote: ... samples were incubated with 1.5 µl EndoH and 2 µl 10× GlycoBuffer 3 (all NEB) buffer at 37°C 1h ...
-
bioRxiv - Biochemistry 2023Quote: ... Total RNA (2 µg) was first annealed with 200 ng random nonamer primers (NEB S1254S) by incubation at 70°C for 5 min ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μL of each ATAC-seq library was added to 2x NEBNext Master Mix (NEB) and 0.4x SYBR Green (Thermo Fisher ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR reactions were performed by combining 12.5 µL Q5 high-fidelity 2× master mix (NEB), 2.5 µL each of 10 µM forward and reverse primers ...
-
bioRxiv - Genomics 2022Quote: ... were enriched from total RNA using the SARS-CoV-2 / TBRV MagIC beads (ElementZero Biolabs) according to the manufacturer’s protocol.
-
bioRxiv - Immunology 2023Quote: ... After digestion the linearized backbone was dephosphorylated by addition of 2 µl rSAP (NEB, #M0371S) and incubation at 37 °C for 1 hour followed by heat inactivation of the enzymes at 80 °C for 20 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR amplified Domain 1 and PCR Domain 2 and HiFi DNA assmbley was performed (NEB). Transformation was performed in DH5α cells (REF) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μg of gRNA was mixed with 3.3 μL of Spy Cas9 NLS (NEB, UK) and incubated for 30 min at RT ...
-
bioRxiv - Systems Biology 2023Quote: ... 2) the CYC terminator by digesting pDL00212 with HindIII-HF (New England Biolabs, Ipswitch, MA) and SpeI-HF (New England Biolabs ...
-
Essential roles of the ANKRD31-REC114 interaction in meiotic recombination and mouse spermatogenesisbioRxiv - Genetics 2023Quote: ... Samples were cooled to 42 °C and 2 μl of β-agarase I enzyme (NEB) was added and incubated at 42 °C for 90 min with occasional vortexing ...
-
bioRxiv - Bioengineering 2024Quote: ... 2) parts were either synthesized as fragments (Twist Bioscience) and subsequently PCRed using Q5 (NEB), or synthesized as duplex oligos (IDT) ...
-
bioRxiv - Cell Biology 2024Quote: ... RNF43 mutants were generated by PCR-subcloning using Q5 High-Fidelity 2× Master Mix (NEB). Domain swapped constructs were generated by in-fusion cloning (Takara Bio) ...
-
bioRxiv - Biophysics 2021Quote: ... the SNAP-tag fragment was digested from the pSNAP-tag (T7)-2 vector (New England Biolabs), inserted into pET-28b plasmid resulting in a construct referred as pET-SNAP ...
-
bioRxiv - Cell Biology 2019Quote: ... the HeLa cells were kept in HeLa culture media treated overnight with 0.2 U/mL of □2-3,6,8,9 Neuraminidase (New England Biolabs) to cleave sialic acid from the cell surface glycans.
-
bioRxiv - Cell Biology 2020Quote: ... and 2) the insert and pcDNA5-FRT-TO were digested with 40U of EcoRV-HF (NEB) and 40U of XhoI (NEB).
-
bioRxiv - Cell Biology 2020Quote: ... peak fractions pooled and reacted with 2-molar excess SNAP-substrate Alexa-488 dye (S9129, NEB) overnight at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Products were then ligated to 3’ adaptor (/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/) by T4 RNA ligase 2(NEB) and 5’ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCr-GrArCrGrArUrCrNrNrNrCrGrArNrNrNrUrArCrNrNrN ...
-
bioRxiv - Molecular Biology 2021Quote: ... The nuclei were harvested and resuspended in 0.5ml cold 1.2x NEB Buffer 2 (New England Biolabs), incubated with 0.3% SDS for 1 hr at 37°C ...
-
bioRxiv - Genomics 2022Quote: ... 10 μl 2X Quick T4 ligase buffer and 2 μl Quick T4 DNA ligase (NEB, M2200L) were added to the reaction and incubate at 37 °C for overnight ...