Labshake search
Citations for New England Biolabs :
751 - 800 of 2731 citations for Who Coplanar & Mono Ortho Pcb + Pcb 170 & Pcb 180 13C12 99% 20 Ng Ml In N Nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2021Quote: FNLS-BE3-NG was generated using the NEBuilder HIFI DNA Assembly kit (New England Biolabs(NEB) cat# E2621L ...
-
bioRxiv - Plant Biology 2021Quote: ... DNA (200 ng) was digested with 8 U of high-fidelity ApekI (New England Biolabs, USA) at 75 °C for 2 h.
-
bioRxiv - Plant Biology 2020Quote: ... 500 ng of the genomic DNA was first treated with NcoI High-Fidelity restriction enzyme (NEB) overnight at 37 °C according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... 100 ng of genomic DNAs were enzymatically digested using EcoRI and MspI (NEB, Ipswich MA, U.S.A) and ligated to EcoR1 and Msp1 adaptors ...
-
bioRxiv - Immunology 2021Quote: ... 500 ng total RNA was used with the Template Switching RT Enzyme Mix (NEB Ipswich, USA) to generate 5’ RACE cDNA ...
-
bioRxiv - Neuroscience 2020Quote: ... About 300 ng of RNA in 3.2 μL was combined with 0.25 μL RNase inhibitor (NEB) and 1 μL CDS primer (5’-AAGCAGTGGTATCAACGCAGAGTACT30VN-3’ ...
-
bioRxiv - Developmental Biology 2022Quote: ... Up to 1000 ng of purified PCR product was used with the HighScribe T7 kit (NEB) and incubated overnight at 37°C ...
-
bioRxiv - Genetics 2019Quote: ... Approximately 250 ng of the purified products were digested with 10 U T7EI (New England Biolabs) according to the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2-10 ng of starting input genomic DNA was digested with 30 units of MspI (NEB). Fragments were ligated to pre-annealed adapters containing 5’-methyl-cytosine instead of cytosine according to Illumina’s specified guidelines ...
-
bioRxiv - Genomics 2021Quote: ... 25 ng of cDNA was digested with 0.5 µl 1:40 diluted RNaseH (New England Biolabs) for 20 min at 37 °C ...
-
bioRxiv - Developmental Biology 2019Quote: ... Embryos were injected with 200-300 pg gRNAs and 1.6 ng EnGen Cas9 protein (#M0646M NEB). The target and gRNA sequences ...
-
bioRxiv - Neuroscience 2019Quote: ... Approximately 250 ng of DNA was digested with BAMH1-HF (R3136, New England Biolabs, Ipswich, MA) at 37°C for 1 hour ...
-
bioRxiv - Evolutionary Biology 2021Quote: We digested 100 ng of DNA of each sample using PstI restriction endonuclease (New England Biolabs), and then ligated fragment ends to common and barcode adapters ...
-
bioRxiv - Biochemistry 2021Quote: ... semi-quantitative PCR with 30 ng cDNA was performed using LongAmp® Taq DNA Polymerase (NEB) with primers in flanking exons detecting both isoforms MALT1A (146 bp ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 ng template DNA were mixed with 0.5 µl Phusion High-Fidelity DNA Polymerase (NEB, USA), 10 µl 5x GC Buffer (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... and then ligated into 50 ng NotI+BamHI-digested pBRα or pACλCI using T4 ligase (NEB) according to standard protocols generating the plasmids listed in Supplementary Table 1A.
-
bioRxiv - Cell Biology 2021Quote: ... For each sample 250 ng of DNA was digested with 5 Units of RNase H (NEB) as control ...
-
bioRxiv - Genetics 2020Quote: ... approximately 250 ng of DNA was digested with BAMH1-HF (R3136, New England Biolabs, Ipswich, MA) at 37°C for 1 hour ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by cDNA NGS library preparation (NEBNext® Ultra RNA Library Prep Kit for Illumina, NEB). The size of the resulting libraries was controlled by the use of a Bioanalyzer High Sensitivity DNA Kit (Agilent Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... 350 ng Dolcetto setA library pool was used to transform 100 μl electrocompetent bacteria (NEB, C3020K), split into 4 × 25 μl electroporations ...
-
bioRxiv - Cancer Biology 2022Quote: ... 200 ng of the purified PCR product was digested with T7 endonuclease I (New England BioLabs) as specified by the manufacturer ...
-
bioRxiv - Biochemistry 2022Quote: ... with recombinant proteins (200-500 ng) and yeast purified CK2 or recombinant human CK2 (NEB, P6010S). Proteins were resolved by SDS-PAGE and the gels were exposed to autoradiography or stained with Coomassie blue.
-
bioRxiv - Immunology 2022Quote: ... Approximately 50-200 ng of gDNA was digested with the restriction endonuclease MspI (New England BioLabs) per the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2022Quote: ... aliquots of 200 ng nucleic acid were treated with 2 U DNase I (New England Biolabs), 10 U S1 nuclease (Thermo Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... 500 ng of polyadenylated RNA was ligated with cRTA using T4 DNA ligase (New England Biolabs) in the presence of NEBNext Quick Ligation buffer (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 100 ng P300core were mixed with NE Builder HiFi DNA Assembly Master Mix (Cat # E2623, NEB) and incubated at 50°C in thermal cycler for 1h ...
-
bioRxiv - Genomics 2023Quote: ... and 500 ng of total RNA was reverse transcribed using random hexamers (NEB ProtoScript®II). Real-time qPCR was performed using QuantiTect SYBR Green qPCR mix (Qiagen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 200 ng of purified PCR product and 1 µl of NEB 2 Buffer (New England Biolabs) in 9.5 µl total volume were first denatured for 5 min at 95°C and then rehybridized by cooling the sample at a rate of 2°C/s to 85°C and a rate of 0.1°C to 25°C to obtain potential heteroduplex DNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... An equal amount of DNA (100 ng/µl) was digested with HindIII enzyme (New England Biolabs) for 1 h at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... 500 ng of input genomic DNA was assembled into 50 μl of reactions with MspI (NEB), incubated at 37°C for 24-26 h ...
-
bioRxiv - Cell Biology 2023Quote: ... total RNA (a minimum of 175 ng) was reverse transcribed using LunaScript RT (New England Biolabs) followed by dilution of 1:5 or 1:10 depending on the normalized RNA input concentration ...
-
bioRxiv - Plant Biology 2023Quote: ... and 500 ng RNA was used to synthesize cDNA using ProtoScript® II Reverse Transcriptase (NEB). Quantitative PCR reactions were performed using StepOnePlus™ Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2023Quote: ... 200 ng of poly(A)+ RNA were digested with a nucleoside digestion mix (New England Biolabs) at 37°C for one hour ...
-
bioRxiv - Developmental Biology 2024Quote: ... The PCR products (∼300 ng) were incubated with 2 μl 10X NEBuffer 4 (New England Biolabs), 1 μl BtsCI restriction enzyme ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were prepared from 200 ng DNA using the NEB Enzymatic Methyl-Seq kit (NEB #E7120) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... 100 ng of gDNA was directly digested with 5 U of EcoRI-HF (New England Biolabs) in the ddPCR Supermix for Probes (no dUTPs ...
-
bioRxiv - Cell Biology 2019Quote: ... and YQDA (D434W Y415A A463W Q433W) fused to a mCherry N-terminal tag were cloned using the NEBuilder HiFi DNA Assembly Cloning Kit (NEB #E5520) and introduced into pBlueScriptII with a VHA-6 promoter and tub terminator using the primers pvha6_fwd gacggtatcgataagcttgatatcggtatactatttattactcgatacttttg ...
-
bioRxiv - Genomics 2019Quote: ... DNA libraries were prepared at the Fundación Parque Científico de Madrid (FPCM) using NEBNext® Ultra™ II DNA Library Prep Kit for Illumina (New England Biolabs) and purified with Agencourt AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Bioengineering 2021Quote: ... the Lenti_Split-BE4-N-Blast plasmid24 was digested with restriction enzymes AgeI and BamHI (New England Biolabs (hereafter, for brevity, NEB)) and a MEGAquick-spin total fragment DNA purification kit (iNtRON Biotechnology ...
-
bioRxiv - Biochemistry 2020Quote: ... The dried glycoproteins were incubated with trypsin for 16 h at 37°C before releasing N-glycans using PNGase F (New England Biolabs, MA). Liberated N-glycans were separated from glycopeptides by C18 Sep Pak SPE cartridges (Waters Corporation ...
-
bioRxiv - Cancer Biology 2020Quote: ALC1 cDNA was cloned into a retroviral pOZ-N vector as well as in a pMSCV-puromycin vector using Gibson Assembly (NEB, E5510S) with an N-terminus FLAG-HA tag ...
-
bioRxiv - Biochemistry 2022Quote: ... was cloned into pGex6P-1 in-frame with an N-terminal 3C-cleavable GST tag using HiFi assembly (New England Biolabs, USA).
-
bioRxiv - Microbiology 2020Quote: ... 66 and 51 bp fragments were amplified by PCR using as template the cDNA obtained from infected Arabidopsis plants with designated primer pairs introducing EcoRI at the N-terminal and XhoI (NEB, CAD) at the C-terminal end (Table S1) ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was generated from RNA using 4 µL of 5X ProtoScript II buffer (cat. n° M0368L, NEB, New England Biolabs, USA), 2 µL of 0.1 M Dithiothreitol (cat ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was generated from RNA using 4 µL of 5X ProtoScript II buffer (cat. n° M0368L, NEB, New England Biolabs, USA), 2 µL of 0.1 M Dithiothreitol (cat ...
-
bioRxiv - Molecular Biology 2020Quote: ... cDNA was subjected to end repair and dA-tailing reaction using NEBNext End repair/dA-tailing module (NEB, cat. n°E7546S) following the manufacturer’s instruction and incubated for 5 min at 20°C and then 5 min at 65°C ...
-
bioRxiv - Molecular Biology 2020Quote: Synthetic RNA fragments bearing a 3′P were subjected to 5′ phosphorylation with T4 PNK 3′ minus (NEB, cat n° M0236S), according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Mutations to the specificity of guides in pTREX-n-Cas9-noTags was performed using a Q5 mutagenesis kit (NEB, Ipswich, Massachusetts). Guides targeting the mitochondrial glutamate dehydrogenase (mGDH ...
-
bioRxiv - Biochemistry 2022Quote: ... Deglycosylation was performed using Peptide-N-Glycosidase F (PNGase F) at 37 °C for one hour according to the supplier’s protocol (New England Biolabs, Hitchin, UK). Enzyme purity and molecular weight were estimated by 12 % SDS-PAGE using mini-PROTEAN 3 system (BioRad ...
-
bioRxiv - Cell Biology 2022Quote: ... An IFT144 construct lacking the N-terminal β-propeller domain (residues 2–349 inclusive; IFT144ΔNFLAG) was made using the Q5® Site-Directed Mutagenesis Kit (NEB).