Labshake search
Citations for New England Biolabs :
751 - 800 of 9159 citations for Swine IL 4 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2023Quote: ... miniprepped (Monarch Plasmid Miniprep Kit, New England Biolabs), and transformed into E ...
-
bioRxiv - Genetics 2023Quote: ... using the Gibson Assembly Cloning Kit (NEB, E2611S). pGADT7-Rnf212bC9A ...
-
bioRxiv - Microbiology 2023Quote: ... The Q5 NEB Mutagenesis Kit (New England Biolabs) was used to add an NES (LQKKLEELEL ...
-
bioRxiv - Plant Biology 2024Quote: ... or the Q5 Site Directed mutagenesis Kit (NEB) according to the supplieŕs instructions were used.
-
bioRxiv - Bioengineering 2024Quote: ... and a Monarch PCR & DNA Cleanup kit (NEB) with the following changes ...
-
bioRxiv - Cancer Biology 2024Quote: ... and purification with Monarch RNA Cleanup Kit (NEB). RNAs were then used for MeRIP assays.
-
bioRxiv - Molecular Biology 2023Quote: ... using the Q5-site directed mutagenesis kit (NEB). The 3×HA epitope tag was amplified from the pPR2-HA3 plasmid (Katris et al ...
-
bioRxiv - Biochemistry 2024Quote: A Q5 Site-Directed Mutagenesis Kit (NEB, E0554S) was used to introduce mutations in amino acid residues predicted to play a role in stabilizing zinc ions ...
-
bioRxiv - Biophysics 2024Quote: ... Gibson Assembly Cloning Kit (NEB, Ipswich, MA, USA) and 5-alpha E ...
-
bioRxiv - Genetics 2024Quote: ... with Phusion high-fidelity DNA Polymerase Kit (NEB), Common sgRNA-R and Primer 1 or Primer 2 (see below).
-
bioRxiv - Microbiology 2023Quote: ... using the Quick Ligase kit (New England Biolabs), and the ligation mix was used to transform the Escherichia coli M15 strain ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1 mL of culture was removed and treated with DNase I (New England Biolabs; 4 µL and 25µL of DNaseI buffer) for 1 h at 30 °C to remove any extracellular DNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were centrifuged for 5 minutes at 5000rpm at 4°C and supernatant treated with 5 mg/ml of proteinase K (New England Biolabs #P8102) for 1 hour at 50°C ...
-
bioRxiv - Cell Biology 2020Quote: ... reaction with 2 to 4 µg of genomic DNA in a 50 µl reaction using the Next High-Fidelity 2x PCR Master Mix (NEB, M0541) (according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... another 1 million cells were processed in only DigWash and during Dam activation incubated with 4 units of Dam enzyme (NEB, M0222L). This Dam control sample serves to account for DNA accessibility and amplification biases.
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted at 1,000 x g for 5 min at 4°C then resuspended in 450 μl of 1X NEBuffer 3 (NEB, cat. # B7003S). Primary restriction enzyme digestion of intact nuclei was carried out overnight at 37°C using 50,000 U of DpnII (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... then incubated for 2 h at 37°C in 100 μl 1x TdT buffer containing 4 μl 10 mM ATP and 1 μl Terminal Transferase (NEB M0315L). Plugs were rinsed with 1 ml tris buffer (10 mM Tris HCl pH 8.0) ...
-
bioRxiv - Epidemiology 2019Quote: ... The MethylRAD library was prepared by digesting 200 ng genomic DNA for each sample using 4 U of the enzyme FspEI (NEB, USA) at 37 °C for 4 h ...
-
bioRxiv - Genetics 2021Quote: ... Nuclei were pelleted at 500 rcf at 4°C for 5 minutes and resuspended in 90 uL 1X Cutsmart Buffer (NEB B7204S). 10 uL of 10U/uL AluI restriction enzyme (NEB R0137S ...
-
bioRxiv - Neuroscience 2020Quote: ... 10 μl of the reaction was directly used for restriction digest using 4 units of BssHII enzyme (New England Biolabs, USA) in a 20 μl reaction ...
-
bioRxiv - Cancer Biology 2021Quote: ... The left lung lobe was used for histological analysis of tumor development (hematoxylin and eosin) after fixation in 4% formaldehyde (Biolabs, Israel). Right lung lobes were minced and digested with 5 mL digestion buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... 1.5 mg of pNL003 plasmid (38) was linearized by incubation at 37 °C for 2-4 h in the presence of EcoRV (NEB R0195S). Transcription reactions (10 mL ...
-
bioRxiv - Biophysics 2021Quote: An in-frame fusion between the human 5-HT5AR from the Presto-Tango cDNA library (4) and the human Gαi1 was made via HiFi DNA assembly (New England Biolabs, Ipswich, MA). Mutations of key contact points between docked ligands and the human 5-HT5AR binding pocket were made via site-directed mutagenesis as directed (Stratagene ...
-
bioRxiv - Cell Biology 2021Quote: ... 50 mM Tris-Cl pH 7.4, 12 mM MgCl2, 1% NP-40, 0.5 mM DTT, 0.1 mg/ml cycloheximide, 80 U/ml NEB murine RNase inhibitor). Beads were transferred to a fresh tube and immunoprecipitated RNA extracted by incubating beads in buffer RLT (Qiagen ...
-
bioRxiv - Biochemistry 2021Quote: ... libraries were generated using 5 μl of the purified RT reaction product and 4-8 cycles of PCR with Q5 high fidelity polymerase (NEB, M0491S). PCR reaction products were column purified ...
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
bioRxiv - Systems Biology 2021Quote: ... for each oligo pool we used 50 femtomoles of template and 4 cycles of PCR in each of multiple 50 microliter reactions (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Plant Biology 2021Quote: ... and cloned into Gateway™ pENTR™ 4 by mixing the linearized vector backbone and PCR product in a 1:1 ratio using Gibson assembly (NEB), before transformation into DH10B electro-competent E ...
-
bioRxiv - Microbiology 2021Quote: ... All generated plasmids of this study (Table 4) were cloned with restriction endonucleases and T4 ligase from NEB (New England Biolabs) or Gibson assembly (NEBuilder® HiFi DNA Assembly ...
-
bioRxiv - Cancer Biology 2020Quote: ... we performed eight 100 μl PCR reactions per sample (4 μg DNA per reaction, 32 μg per mouse) using Q5 High-Fidelity 2x Master Mix (New England Biolabs, M0494X). The PCR products were purified with Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 μl of the diluted samples was then denatured by addition of 4 M urea and Proteinase K (40 U/ml; New England Biolabs #P8107S), incubated for 5 min at 65°C ...
-
bioRxiv - Microbiology 2022Quote: ... containing ampicillin resistance marker were amplified by PCR with corresponding primers (Supplementary Data 4) in Q5® High-Fidelity 2X Master Mix (New England BioLabs). Both the insert (MCR-MOR ...
-
bioRxiv - Molecular Biology 2020Quote: ... then incubated for 2 h at 37°C in 100 μl 1x TdT buffer containing 4 μl 10 mM ATP and 2 μl Terminal Transferase (NEB M0315L). Plugs were rinsed with 1 ml tris buffer (10 mM Tris HCl pH 8.0) ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was generated from RNA using 4 µL of 5X ProtoScript II buffer (cat. n° M0368L, NEB, New England Biolabs, USA), 2 µL of 0.1 M Dithiothreitol (cat ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was generated from RNA using 4 µL of 5X ProtoScript II buffer (cat. n° M0368L, NEB, New England Biolabs, USA), 2 µL of 0.1 M Dithiothreitol (cat ...
-
bioRxiv - Cancer Biology 2020Quote: ... the oligonucleotides containing the different gRNA-pairs (Supplementary Table 4) were amplified with Phusion High-Fidelity polymerase (New England Biolabs, M0530S) using primer F5 and R1 (Supplementary Table 2) ...
-
bioRxiv - Synthetic Biology 2022Quote: All pLS plasmids listed in Supplementary Table 4 were synthesized as gBlocks by IDT and circularized either by ligation with T4 DNA ligase (New England Biolabs, USA), or ...
-
bioRxiv - Synthetic Biology 2019Quote: The adipic acid biosensing plasmid (JBx_101898) was assembled of 4 DNA parts by NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs, MA): First ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μg of the extracted genomic DNA was digested for 4 h at 37☐ using 10 U MmeI (New England Biolabs). The DNA was then immediately dephosphorylated by treatment with 1 U calf intestine alkaline phosphatase (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... samples were washed four times with 2×SSC and stored at 4 ⁰C in 2×SSC supplemented with 1:1000 murine RNase inhibitor (NEB M0314L) prior to imaging.
-
bioRxiv - Molecular Biology 2021Quote: ... mCherry and control (GAPDH) expression levels were measured separately by qPCR from 4 uL of diluted cDNA using Taq DNA Polymerase (NEB, #M0270L), dsGreen DNA detection dye (Lumiprobe ...
-
bioRxiv - Microbiology 2022Quote: ... Purified protein (4 μg) was deglycosylated with 500 U of Endoglycosidase H (Endo H) (New England Biolabs, Ipswich, MA, United States) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2022Quote: ... with a terminal elongation step for 4 min at 72°C employing a proofreading Taq polymerase (Q5 High-Fidelity DNA polymerase, New England Biolabs, Germany). After verification of the amplicon sequence ...
-
bioRxiv - Neuroscience 2023Quote: ... the coverslips were washed in 2×SSC for 30 minutes for a total of four washes and then stored at 4°C in 2×SSC supplemented with 1:100 Murine RNase inhibitor (New England Biolabs, M0314S) for no longer than 2 weeks prior to imaging.
-
bioRxiv - Genetics 2023Quote: ... 4 µg of DNA in 80 µl reaction were incubated at 37°C for seven minutes and randomly fragmented to 300 bp – 4 kb size products using NEBNext® dsDNA Fragmentase (New England BioLabs) and then cleaned using 0.5x SPRI beads ...
-
bioRxiv - Genomics 2023Quote: ... cells were then pelleted at 500xg for 2 min at 4°C and then resuspended in 200 μl of 1 × T4 DNA ligase buffer (NEB, B0202S) containing 0.2% SDS ...
-
bioRxiv - Genetics 2023Quote: ... After 48 h cells were incubated for 30 min at 37 °C with SNAP-Oregon green (NEB, final concentration 4 µM). Cells were then incubated for 30 min at 37 °C in fresh media to wash off unbound substrate ...
-
bioRxiv - Cancer Biology 2023Quote: ... then incubated for 2 h at 37°C in 100 μl 1x TdT buffer containing 4 μl 10 mM ATP and 1 μl Terminal Transferase (NEB M0315L). Plugs were rinsed with 1 ml Tris buffer (10 mM Tris HCl (pH 8.0)) ...
-
bioRxiv - Microbiology 2023Quote: ... Digestion products were diluted by the addition of 4 mL 1.1× T4 DNA Ligase Reaction Buffer (New England BioLabs® Inc) with 1% Triton X-100 and incubated for 1 h at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 μg of venom in 10 µL of reducing SDS-PAGE buffer (6X stock solution, NEB B7024S with 30% β-mercaptoethanol) was run per lane on BioRad™ Mini PROTEAN pre-cast TGX acrylamide gels (15 well ...