Labshake search
Citations for New England Biolabs :
751 - 800 of 6327 citations for 6 Fluoro 2 3 dihydro 4H 1 benzothiopyran 4 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... For assessment of HAC1spliced mRNA the Luna Universal Probe One-Step RT-qPCR Kit (NEB) was used with 2 µl of a 50 ng/ µl RNA sample ...
-
bioRxiv - Cell Biology 2023Quote: ... RT-qPCR was performed using Luna® Universal One-Step RT-qPCR Kit (E3005S, NEB). 20μl reactions using 200nM primers and <100ng RNA were run on ABI StepOnePlus Real Time PCR system following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were run using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) on a CFX384 (Bio-Rad) ...
-
bioRxiv - Cell Biology 2023Quote: ... using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs, Ipswich, MA, USA) and a BIORAD CFX Opus 384 system ...
-
bioRxiv - Plant Biology 2024Quote: ... and first strand cDNA was synthesized with One-Taq RT-PCR kit (New England Biolabs), according to manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2024Quote: ... The first one made use of Q5 mutagenesis following the manufacturer’s instructions (New England Biolabs), but due to the high GC-content of exon1 specific for the ZNRF3 long isoform ...
-
bioRxiv - Genomics 2024Quote: ... a SYBR green I based qRT-PCR kit (Luna Universal One-Step NEB, Ipswich, USA) was used in PCR mixtures (20 µl ...
-
bioRxiv - Microbiology 2024Quote: ... template genomic DNA was prepared by picking one colony into 50 μL ThermoPol buffer (NEB) with 0.5 μL thermolabile Proteinase K (NEB) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4 μl of RCA mixture was combined with 4 μl Restriction enzyme buffer (New England Biolabs), 13 μl MilliQ ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 4 U of SssI (NEB) or 4 µl purified Eco72IM (diluted 1:100 ...
-
bioRxiv - Neuroscience 2019Quote: ... in 1X NEBbuffer 4 (NEB #B7004), or an equivalent volume of ultra-pure water and 1X NEBbuffer 4 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 4 U DNase I (NEB) was used for each 200 μl to digest the DNA nanoswitches at 37 °C for 1 hour ...
-
bioRxiv - Bioengineering 2021Quote: ... 4 μl 10mM dNTPs (N0477L, NEB), 1 μl RNase Inhibitor (30281 ...
-
bioRxiv - Genetics 2020Quote: ... 4 μl T4 DNA polymerase (NEB), 1 μl DNA polymerase Klenow (NEB) ...
-
bioRxiv - Genomics 2019Quote: ... 4 μl Klenow fragment (NEB M0212L) and 10 μl 10 nM dATP 20 min at 37 °C and 20 min at 75°C to inactivate the reaction ...
-
bioRxiv - Physiology 2019Quote: ... 4 μl of 10xG7 Buffer (NEB), 4 μl of 10% NP-40 (NEB ...
-
bioRxiv - Pathology 2019Quote: ... 4 U/ml RNase inhibitor (NEB) and proteinase inhibitor cocktail (Roche ...
-
bioRxiv - Biophysics 2019Quote: ... 4 µL Murine RNase inhibitor (NEB), 1 µL T7 polymerase (NEB) ...
-
bioRxiv - Pathology 2020Quote: ... 4 U/ml RNase inhibitor (NEB) and proteinase inhibitor cocktail (Roche ...
-
bioRxiv - Genetics 2020Quote: ... 4 Units of terminal transferase (NEB) were added together with dCTP in a final concentration of 0.1 mM ...
-
bioRxiv - Biochemistry 2021Quote: ... 4 U of Proteinase K (NEB) were added to the reaction and incubation continued for 30 minutes at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: ... 4 mg/ml BSA (NEB B9000S), 300 U/μl RL Lysozyme ...
-
bioRxiv - Microbiology 2020Quote: ... and 4 U/ml apyrase (NEB) were added and the reaction was incubated overnight at room temperature ...
-
bioRxiv - Genomics 2024Quote: ... 4 μl of Inorganic Pyrophosphatase (NEB) and 2 μl of Phi29 DNA Polymerase (NEB) ...
-
bioRxiv - Genomics 2024Quote: ... 0.67x NEB buffer 4 (NEB, B7004S), 0.13% Triton X-100 (sigma ...
-
bioRxiv - Genomics 2022Quote: ... 7 μl PEG 8000 (17.5% final) and 1 μl of T4 RNA ligase 2 KQ (NEB, M0373L) in 1X T4 RNA ligase buffer ...
-
bioRxiv - Biochemistry 2020Quote: 1 μg of N protein was dissolved in 36 μL H218O and 2 μL 10x glycobuffer (NEB). To this solution 2 μL PNGase F was added and the reaction mixture was incubated at 37 °C for 16 h ...
-
bioRxiv - Genomics 2021Quote: ... and NEBNext® Multiplex Oligos for Illumina® Index Primers Set 1 and 2 (NEB #E7335S, #E7500S), following the manufacturer’s instructions with minor modifications ...
-
bioRxiv - Molecular Biology 2022Quote: ... All enzymatic reactions were performed as a 1-step reaction with 1x Glycobuffer 2 (New England Biolabs), 10 μg RBD produced in CHO-S- ...
-
bioRxiv - Molecular Biology 2023Quote: ... The samples were multiplexed with NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 and 2) (NEB). Size selection steps were performed with Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... with NEBNext Multiplex Oligos for Illumina (Dual Index Primers Sets 1 and 2) (NEB #E7600S and #E7780S), with two-sided size selection around a mode of 480 base pairs ...
-
bioRxiv - Systems Biology 2019Quote: ... vaccinia mRNA 2’-O-methyltransferase (NEB, 250 U every 2 h) and water ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2′ O-methylated using Vaccinia VP39 (2′ O Methyltransferase) (NEB) in a reaction that also included 1X capping buffer (NEB) ...
-
bioRxiv - Cell Biology 2020Quote: ... Renilla luciferase was PCR amplified from pMT-DEST48-FLP 31 with Renilla Luciferase Forward: 5’-TGGAAGCTTGGCATTCCGGTACTGTTGGTAAAGCCACCATGACTTCGAAAGTTTATG-3’ and Renilla Luciferase Reverse: 5’-TGGAAGCTTTTATTATTGTTCATTTTTGAGAAC-3’ and digested with HindIII (NEB). Renilla luciferase was then ligated into pGL3-Control digested HindIII (NEB ...
-
bioRxiv - Immunology 2022Quote: ... and we digested up to 3 μg of DNA with 3 μl of EcoRI-HF restriction enzyme (New England Biolabs) per 50 μl.
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ adapter (RNA oligo: 5’P-GAUCGUCGGACUGUAGAACUCUGAAC-3’InvdT) was pre-adenylated prior to use (5’ DNA adenylation kit, NEB, according to the manufacturer’s instructions) ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA fragments were end-repaired and T-tailed with Klenow fragment lacking 5’ → 3’ and 3’ → 5’ exonuclease activity (NEB). In-house adapters containing 8-nucleotide unique molecular identifier (UMI ...
-
bioRxiv - Cancer Biology 2019Quote: ... PCR amplification of the target locus (forward primer: 5’-GGTTCTCAGTGCACGCATTT-3’; reverse primer: 5’-ACAACGATTTTCCTGGCATCT-3’) with Q5 polymerase (NEB), and Sanger sequencing of PCR products by the Keck Biotechnology Resource Laboratory at Yale ...
-
bioRxiv - Molecular Biology 2019Quote: ... Fragment ends were repaired using the NEBNext End Repair Module and adenosine was added at the 3’ ends of fragments using Klenow fragment (3’ to 5’ exo minus, New England Biolabs), universal adaptors were ligated to the A-tailed DNA fragments at room temperature for 1 h with T4 DNA ligase (New England Biolabs ...
-
bioRxiv - Genomics 2019Quote: ... fragmented nascent RNA was dissolved in H2O and incubated with 10 pmol of reverse 3’ RNA adaptor (5’p-rNrNrNrNrNrNrGrArUrCrGrUrCrGrGrArCrUrGrUrArGrArArCrUrCrUrGrArArC-/3’InvdT/) and T4 RNA ligase I (NEB) under manufacturer’s conditions for 2 h at 20°C ...
-
bioRxiv - Systems Biology 2021Quote: ... 1 µL of the boiled colony was used for PCR with primer pair (JGI_27F: 5’-AGAGTTTGATCCTGGCTCAG-3’and JGI_1391R: 5’-GACGGGCRGTGWGTRCA-3’) with NEB Q5 Polymerase (New England Biolabs, Ipswitch, MA). The PCR amplicon was confirmed by agarose gel electrophoresis and the sequence was determined using conventional Sanger Sequencing (Genewiz LLC ...
-
bioRxiv - Microbiology 2021Quote: ... were generated by PCR amplification of either full-length pfget4 or nucleotides encoding for the first 246 amino acids of PfGet2CD using PfGet4-EcoRIF (5’-GTACCGGAATTCATGAAAAAGTTCAAATTTAGTAAAGAAAAGCTAGCC-3’)/PfGet4-XhoISalIR or PfGet2CD-BamHIF (5’-GTACGCGGATCCATGGATAAAAATACATTAAAAAGAA-3’)/PfGet2CD-XhoISalIR (5’-AGACCGGTCGACCTCGAGTTATTCATGTTTCGTAATAATAAATTG-3’) primer pairs and subsequently cloning at corresponding sites in pMALc2X plasmid (New England Biolabs).
-
bioRxiv - Cell Biology 2022Quote: ... A 3’ RNA adapter /5’Phos/rArGrArUrCrGrGrArArGrArGrCrArCrArCrGrUrC/3’SpC3 was ligated to the samples using T4 RNA Ligase (NEB, M0437M) at room temperature for 75 min.
-
bioRxiv - Molecular Biology 2022Quote: ... 1000 ng of DNA diluted in 27 μL of nuclease-free water was dephosphorylated by the addition of 3 μL of 10X CutSmart Buffer and 3 μL of Quick Calf Intestinal Phosphatase (NEB) and then incubated at 37ºC for 10 minutes ...
-
bioRxiv - Biophysics 2022Quote: ... the purified 8.2 kb DNA linker was annealed to the oligo DNA handle with 3’-biotin (5’-TGGACTGATGCGGTATCTGCGATATCCTA CGCAGGCGTTT-3’-biotin) in PBS at room temperature for 3 hr followed by purification using Monarch DNA purification kit (NEB).
-
bioRxiv - Genetics 2022Quote: ... was assessed via PCR amplification using OneTaq 2x Master Mix (forward primer DLO1142 5’-ACCCATTTCCCATTCAATCA-3’ reverse primer DLO1143 5’-TTGTAATCTGCCCCAAAAGG-3’) and subsequent HpaII restriction digest (New England Biolabs). DLW135 carried a wild type allele of pho-9 ...
-
bioRxiv - Cell Biology 2019Quote: ... and pcDNA4/TO (forward primer 5’ GACACGTGAGAGGGAGTAGAAGCCGCTGATCAGCCTCGACTG 3’ and reverse primer 5’ CAATGGGGCGGAGTTGTTAC 3’) PCR products were assembled using Gibson Assembly (New England Biolabs) [36] ...
-
bioRxiv - Genetics 2019Quote: ... forward (5’-AAGCCAAGTCTGCATGAGTA-3’) and reverse (5’-TAAATGTGCCACTGACTAAAT-3’) followed by a restriction enzyme digestion with Sau96I (New England Biolabs) at 37ºC for 2-3 hours ...
-
bioRxiv - Neuroscience 2019Quote: ... encoding full length Ppp3cc was amplified with primers 5’- AGATTACGCTATCTGTACAGAATTCACCATGTCCGTGAGGCGC-3’ and 5’-GGCCGCTAGCCCGGGTACCGAATTCTTACAGGGCTTTCTTTCCATGGTC-3’ and inserted into pCAG-HA vector using NEB Builder (NEB).
-
bioRxiv - Evolutionary Biology 2019Quote: ... DNA for the Ty1 probe was amplified with primers 5’-TGGTAGCGCCTGTGCTTCGGTTAC-3’ and 5’-CATGTTTCCTCGAGTTAGTGAGCCCTGGCTGTTTCG-3’ and Phusion DNA polymerase (New England Biolabs). DNA for the Ty2 probe was generated with primers 5’-TGGTAGCGCCTATGCTTCGGTTAC-3’ and 5’-GCAATATTGTGAGCTTTTGCTGCTCTTGG-3’ ...