Labshake search
Citations for New England Biolabs :
7851 - 7900 of 10000+ citations for Human Oxidized low density lipoprotein receptor 1 OLR1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: RNA sequencing library was performed using the NEBNext® Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760L), following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... several hundred cells exhibiting highest fluorescent intensity in the corresponding channel were collected and subjected to whole genome amplification using a commercially available whole genome amplification kit (WGA, New England BioLabs) followed by PCR amplification ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR products were gel purified and transcribed in vitro using the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB). Cas9 mRNA was synthesized from the pX330 plasmid using the mMESSAGE mMACHINE® T7 Ultra (Thermofisher ...
-
bioRxiv - Developmental Biology 2021Quote: A plasmid encoding mouse ADAMTS6 with a C-terminal myc/his tag was generated previously (31) and used for site-directed mutagenesis (Q5 Site-Directed Mutagenesis Kit; E0554; New England BioLabs) to introduce Ala at Glu404 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The Nanopore library was prepared using Oxford Nanopore Technologies ligation sequencing kit (SQK-LSK108) from 4 μg of T7 endonuclease I (New England Biolabs) treated WGA ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bulk KP libraries were prepared from 500 ng of total RNA by the Genome Analysis and Technology Core at the University of Virginia using mRNA oligo dT-purified with the NEB Next Ultra RNA library preparation kit (NEB).
-
bioRxiv - Evolutionary Biology 2020Quote: ... and single bands of the expected size were excised and purified with a Monarch DNA Gel Extraction kit (New England Biolabs). Libraries were constructed using 1ng of input DNA in a Low Input ...
-
bioRxiv - Microbiology 2021Quote: ... or riboPOOLs (siTOOLs Biotech) before library preparation with the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). The sequencing was performed at the Center for Cancer Research Genomics Core Facility ...
-
bioRxiv - Microbiology 2021Quote: ... Official CDC SARS-CoV-2 N1 gene primers and TaqMan probe set were used [58] with the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs):
-
bioRxiv - Developmental Biology 2021Quote: ... DNA libraries for RNAseq analysis were prepared using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs, NEB) and NEBNext rRNA Depletion Kit (Human/Mouse/Rat ...
-
bioRxiv - Developmental Biology 2020Quote: ... 20ng of total RNA were used to generate barcoded RNA-seq libraries using the NEBNext Ultra RNA Library preparation kit (New England Biolabs). The size and the concentration of the libraries were checked using the TapeStation 2200 DNA 1000 chip ...
-
bioRxiv - Developmental Biology 2020Quote: ... Fragmentation of mRNA followed by reverse transcription and second strand cDNA synthesis was done using NEBNext Ultra RNA Library Prep Kit for Illumina (E7530, NEB). Sequencing libraries were constructed using ThruPLEX DNA-seq kit (Takara R400428) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 3 fragments have been inserted into pCS2+ plasmid linearized with Xho1 using the Gibson Assembly Cloning Kit (New England Biolabs): a first fragment of 4161bp of the ancBE4max to the PIM domain (amplified using the primers F-5’-CGATTCGAATTCAAGGCCTCATGAAACGGACAGCCGAC-3’ and R-5’-CGGTCTGGATCTCGGTCTTTTTCACGATATTC-3’) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and Poly-A mRNA-seq libraries from such samples were prepared using the Ultra II Directional RNA Library kit (New England BioLabs) according the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Stranded RNA-seq library construction was then performed on the rRNA-depleted RNA using the Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs), following manufacturer’s specifications for library construction and multiplexing ...
-
bioRxiv - Microbiology 2020Quote: ... Final Illumina libraries were assessed for quality using an Agilent Bioanalyzer DNA High Sensitivity Assay and qPCR quantification was performed using NEBNext Library Quant kit for Illumina (New England Biolabs). Individual libraries were pooled equimolarly ...
-
bioRxiv - Molecular Biology 2022Quote: ... which were subsequently transcribed to produce copies of the mRNAs using an in vitro transcription kit (New England Biolabs, UK) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... or SalI (pT7/SL3 or pT7/FLC background) and RNA transcribed using a HiScribe T7 High Yield RNA Synthesis kit (NEB) following the manufacturers’ protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... the BsaI cut site present in the newly assembled vector was converted to a BsmBI cut site using the Q5 Site-Directed Mutagenesis kit (NEB).
-
bioRxiv - Molecular Biology 2022Quote: ... Ribosomal RNA was removed from the samples using NEBNext® Ultra™ Directional RNA Library Prep Kit (NEB, Massachusetts, U.S.). Sequencing libraries were generated using NEBNext® Ultra™ RNA Library Prep Kit for Illumina® (NEB ...
-
bioRxiv - Biochemistry 2022Quote: ... a cysteine was added to the N-terminus of the coding sequence directly after the precision protease recognition site or after the six-histidine tag on the C-terminus using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs).
-
bioRxiv - Molecular Biology 2019Quote: ... 750 ng RNA were used to build the next generation sequencing libraries with the NEBNext Ultra II RNA Library Prep Kit for Illumina (New England BioLabs), NEBNext Poly(A ...
-
bioRxiv - Molecular Biology 2019Quote: ... 50 ng of DNA in 50 ul water was used for library preparation using the Ultra II library kit (NEB) as per the manufacturer’s instructions with 6 cycles at the amplification step.
-
bioRxiv - Neuroscience 2021Quote: ... guide RNA (gRNA) sequences were inserted into pU6-BbsI-chiRNA 54 using the Q5 site-Directed Mutagenesis Kit (New England Biolabs). Each PCR used a common primer GAAGTATTGAGGAAAACATA and a primer containing the gene specific gRNA sequence followed by GTTTTAGAGCTAGAAATAGC ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA library preparation was performed according to the standard protocol of the NEBNext Ultra RNA Library Prep Kit for Illumina (New England BioLabs). The synthesized double-stranded cDNA was end-repaired using NEBNext End Prep Enzyme Mix before ligation with NEBNext Adaptor for Illumina ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was extracted as above and 300 ng of total RNA was used for library preparation using the NEBNext Ultra II Directional Library Prep Kit for Illumina with the mRNA isolation module and NEBNext Multiplex Oligos for Illumina (New England Biolabs). DNA quality was assessed by Fragment Analyzer NGS (Agilent) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Libraries were constructed from 2.5 ng of DNA and prepared using the NEBNext Ultra II DNA Library Prep Kit for Illumina with 9 PCR cycles (NEB #E7645S, New England Biolabs). Library quality was assessed by High Sensitivity DNA Assay on an Agilent 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Neuroscience 2021Quote: ... The NEBNext Ultra Directional RNA Library Prep Kit for Illumina was used to process the samples according to the protocol NEB #E7420S/L (New England Biolabs) to fragments of 300-500 bps ...
-
bioRxiv - Molecular Biology 2020Quote: ... the sgRNA products synthesized by VSW-3 RNAP and T7 RNAP were purified with Monarch RNA Cleanup kit (New England Biolabs) and then further purified by high performance liquid chromatography (HPLC ...
-
bioRxiv - Molecular Biology 2021Quote: Micro-C sequencing libraries were generated by using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB #E7645) with some minor modifications ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA-seq library was prepared using NEBNext® Ultra™ directional RNA library prep kit (New England BioLabs, MA, USA) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2021Quote: ... mRNA was isolated and sequencing libraries prepared using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs) by the Centre for Genomic Research (University of Liverpool) ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA-Seq libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB, cat# E7760S) with the NEBNext rRNA Depletion Kit (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: HA-AHCY was purchased from VectorBuilder and mutations were introduced by PCR-based mutagenesis using Q5 Site-Directed Mutagenesis Kit (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ adapter (RNA oligo: 5’P-GAUCGUCGGACUGUAGAACUCUGAAC-3’InvdT) was pre-adenylated prior to use (5’ DNA adenylation kit, NEB, according to the manufacturer’s instructions) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The mRNA abundance levels were determined using 200 ng total RNA for each sample in technical replicates using Luna Universal One-Step RT-qPCR kit (New England BioLabs) and SYBR Green as detection agent and gene-specific primers (Table S2) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The two fragments were cloned into KpnI/SpeI-digested pMDC32 vector via HiFi DNA Assembly Cloning kit (New England Biolabs).
-
bioRxiv - Molecular Biology 2021Quote: ... The three DNA fragments were cloned into SacII/XhoI-digested pUC57-TAS3a via HiFi DNA Assembly Cloning kit (New England Biolabs).
-
bioRxiv - Molecular Biology 2021Quote: ... The two fragments were cloned into KpnI/SpeI-digested pMDC32 vector via HiFi DNA Assembly Cloning kit (New England Biolabs).
-
bioRxiv - Molecular Biology 2021Quote: ... The two DNA fragments were inserted into EcoRV/SmaI-digested pEU-E01-MCS vector via HiFi DNA Assembly Cloning kit (New England Biolabs).
-
bioRxiv - Molecular Biology 2021Quote: ... The two fragments were cloned into KpnI/SpeI-digested pMDC32 vector via HiFi DNA Assembly Cloning kit (New England Biolabs).
-
bioRxiv - Molecular Biology 2021Quote: ... The two fragments were cloned into KpnI/SpeI-digested pMDC32 vector via HiFi DNA Assembly Cloning kit (New England Biolabs).
-
bioRxiv - Molecular Biology 2021Quote: ... The two fragments were cloned into KpnI/SpeI-digested pMDC32 vector via HiFi DNA Assembly Cloning kit (New England Biolabs).
-
bioRxiv - Molecular Biology 2021Quote: ... the pyrimidines present in the TOP motif of the reporters were replaced with purines using Q5 site directed mutagenesis kit (NEB) as per the manufacturer’s protocol using the oligos listed in the Supplementary file 1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and up to 100 ng of RNA was used for library preparation using NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB). The libraries were prepared according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: All genome-editing plasmids were constructed using the seamless cloning with Golden Gate Assembly using NEB Golden Gate Assembly Kit (BsaI-HF v2) (E1601, New England Biolabs). The ODNs for Golden Gate Assembly were automatically designed with an in-house software.
-
bioRxiv - Molecular Biology 2021Quote: ... Deletion of S106 and T107 was performed from the wt template above using the Q5 Site-Directed Mutagenesis Kit (New England BioLabs) and sequence verified ...
-
bioRxiv - Molecular Biology 2021Quote: Sequencing libraries were generated from 1.2 ng of DNA using the NEBNext Ultra II DNA library preparation kit (NEB, E7645) with 9 cycles of PCR ...
-
bioRxiv - Biophysics 2022Quote: ... was performed using plasmid pHSCRP-His6-H17C-C178S [constructed from plasmid pAKCRP-His6 (16) using site-directed mutagenesis (Q5 Site-Directed Mutagenesis Kit, NEB)].
-
bioRxiv - Biophysics 2022Quote: ... single point mutations were introduced to the respective wild-type plasmids by site-directed mutagenesis using the Q5 site-directed mutagenesis Kit (NEB). The used primers are listed in table 1.