Labshake search
Citations for New England Biolabs :
7851 - 7900 of 10000+ citations for 2 Arachidonoylglycerol 2 AG CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... the DNA of the two parents that generated the cross was extracted from flash-frozen young leaves using NEBNext Ultra II kit (NEB) and sequenced to ~40x coverage as 150 bp reads on an Illumina MiSeq at the Biological Nanostructures Lab in the California NanoSystem Institute at UC Santa Barbara ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA-Seq libraries were prepared from 1μg high quality RNA using the NEBNext Poly(A) mRNA Magnetic Isolation Module and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs), according to the manufacturer’s guidelines ...
-
bioRxiv - Plant Biology 2021Quote: ... PCR product of the expected size was purified from the agarose gel after electrophoresis using the Monarch DNA Gel Extraction Kit (NEB), and cloned into the pDONR207 vector (Invitrogen ...
-
bioRxiv - Plant Biology 2020Quote: ... and Fls3 clones was performed in the entry vectors using the Q5 Site-Directed Mutagenesis kit following the manufacturer’s instructions (New England Biolabs, www.neb.com). For a list of all primers and constructs used in this study ...
-
bioRxiv - Microbiology 2021Quote: ... The product was then transcribed to crRNA using HiScribe T7 Quick High Yield RNA Synthesis kit (New England Biolabs; E2050S) incubating at 37°C overnight ...
-
bioRxiv - Microbiology 2021Quote: ... cholerae H-NS protein was purified as previously described (4) using the IMPACT-kit (New England Biolabs, Catalogue No. #E6901S). Briefly ...
-
bioRxiv - Microbiology 2020Quote: ... pDWV-S-GFP and the parental pDWV-304 were produced using HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was subjected to OneStep qRT-PCR analysis using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) and a CFX96 Real-Time System ...
-
bioRxiv - Molecular Biology 2021Quote: ... with primers carrying the appropriate restriction enzymes sites AscI/SbfI (See Table S6 for the list of primers used) and cloned using Quick DNA Ligation Kit (NEB) into dCas9-empty-GFP vector ...
-
bioRxiv - Molecular Biology 2021Quote: ... All cDNA libraries were constructed according to the standard protocol of the NEBNext Ultra RNA Library Prep Kit for Illumina (New England BioLabs). The synthesized double-stranded cDNA was end-repaired using NEBNext End Prep Enzyme Mix before ligation with NEBNext Adaptor for Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... The mRNA libraries were generated using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (E7760L, New England Biolabs) and NEBNext Poly(A ...
-
bioRxiv - Microbiology 2020Quote: ... Linkers (5’-ACTAGTTCCGAGCTCGAG-3’) with restriction sites for SpeI and XhoI were introduced by PCR based mutagenesis using the Q5 mutagensis kit (NEB) after codon 466 of nsP2 (2EGFP ...
-
Identification and biochemical characterization of a novel eukaryotic-like Ser/Thr kinase in E. colibioRxiv - Microbiology 2020Quote: Plasmid derivatives of pKR72 with pho-lac fusions were constructed in frame with different codons of YegI using the Q5 Site-Directed mutagenesis kit (NEB). Primers used to generate pho-lac fusions in frame to different codons E439 (KR230/KR231) ...
-
bioRxiv - Microbiology 2019Quote: ... The DNA was isolated from the supernatant using the polymerase chain reaction (PCR) clean-up kit (New England Biolabs®) and quantified using a nanodrop ...
-
bioRxiv - Microbiology 2019Quote: ... myc epitope tag insertion and TEXEL2 point mutations were introduced into pTub-Gra44-HPT using the Q5 site directed mutagenesis kit (NEB) and TEXEL point mutations were accomplished similarly with Quikchange site-directed mutagenesis kit (Agilent).
-
bioRxiv - Genomics 2020Quote: ... end repaired DNA using the Ligation Sequencing kit (SQK-LSK-109; Oxford Nanopore) and NEBNext Ligation Module (New England BioLabs). Following a further 0.4 x volume Ampure-XP purification ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA-Seq libraries were prepared using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs # E7420S) by following the company’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... Purified ChIP DNA was used to prepare Illumina multiplexed sequencing libraries using the NEBNext Ultra II DNA Library Prep kit and the NEBNext Multiplex Oligos for Illumina (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... The fragments were end-repaired and ligated with Illumina compatible adaptors using the NEBNext UltraTM II DNA Library Prep Kit (NEB). The adaptor-ligated DNA was hybridized to custom Agilent biotinylated oligonucleotide probes across a 700bp region (53032 probes ...
-
bioRxiv - Cell Biology 2021Quote: ... and pGEX-GST-p130593-790 R680A L682A were generated by site-directed mutagenesis using the Q5 Site-Directed Mutagenesis Kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Sequencing libraries were generated using NEBNext® Ultra™ RNA Library Prep Kit for Illumina® (New England BioLabs, USA) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Cell Biology 2021Quote: RNA sequencing libraries were prepared using the NEBNext Ultra RNA Library Prep Kit for Illumina using manufacturer’s instructions (NEB, MA). mRNAs were enriched with Oligod(T ...
-
bioRxiv - Cell Biology 2020Quote: ... CASP1 and CASP4 CDS were amplified from the obtained library and cloned into the pMSCV-puro vectors The caspase-4 catalytically dead C258A pMSCV-puro vector was generated from the wild-type pMSCV-puro-CASP4 through site-directed mutagenesis by PCR using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). The CASP4 and GSDMD-targeting lentiviral vectors (pGIPZ ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was isolated with the PureLink RNA Mini Kit (12183018A, Thermo) and cDNA was synthesized with ProtoScript First Strand cDNA (E6300S, New England Biolabs). RT-PCR was performed with the Power SYBR Green PCR Master Mix 2X (4367659 ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA synthesis was performed for 60 min at 42 °C and 5 min at 80 °C using ProtoScript II First Strand cDNA synthesis kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Adapters were ligated using the Genomic DNA by Ligation kit (SQK-LSK109, Oxford Nanopore Technologies) and NEBNext Quick T4 DNA Ligase (E6056, NEB) followed by AMPure XP bead clean-up ...
-
bioRxiv - Cell Biology 2021Quote: ... coding sequence was amplified from Arabidopsis cDNA and assembled into a pGreen0179-35S-spFLA11-His-YFP vector using NEBuilder HiFi DNA Assembly kit (NEW ENGLAND Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: Library construction was performed with 20ng of input total RNA using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina - polyA mRNA workflow (New England Biolabs). The libraries were sequenced with a NextSeq 500 High Output 75 cycle kit (Illumina) ...
-
bioRxiv - Cell Biology 2021Quote: ... The fragments were cloned into the srpHemo plasmid using an Infusion HD cloning kit after its linearization with NotI (NEB).
-
bioRxiv - Genomics 2019Quote: ... Illumina sequence libraries were prepared using the NEB Next Ultra Directional RNA Library Prep Kit (New England Biolabs, Ipswich, MA). Quality and quantity of the cDNA libraries were validated with a Tapestation 2200 Instrument (Agilent ...
-
bioRxiv - Cell Biology 2021Quote: ... and the other lacking a conserved region of the FAB domain (1937-2051aa, 115aa) using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). We generated a 282bp deletion of the PDZ domain to create the cnoΔPDZ-GFP ...
-
bioRxiv - Cell Biology 2021Quote: Intracellular levels of mRNA for TRAP complex subunits were estimated by RT-qPCR using Luna Universal One-Step RT-qPCR Kit (NEB) following total RNA isolation with RNeasy Mini Kit (Qiagen) ...
-
bioRxiv - Bioengineering 2022Quote: ... Linearized plasmids were used as templates and RNA products were then produced using the HiScribe T7 RNA Synthesis Kit (NEB) per manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2022Quote: Sequencing libraries were prepared using the NEBNext Ultra II Directional Kit with polyA selection module (New England Biolabs, MA, USA). In brief ...
-
bioRxiv - Molecular Biology 2022Quote: 1 μg of total RNA was used to synthesize cDNA with dTALE gene specific primer dTALE-GSP_R0 (cgacttgagcagcaggagatgc) using the ProtoScript®II first strand cDNA synthesis kit (New England Biolabs) according to the manufacturer’s manual ...
-
bioRxiv - Biochemistry 2022Quote: ... transcripts containing artificial 5’ UTRs were performed using PCR-amplified templates and the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... After depletion 80 ng of each RNA sample was used to synthesized cDNA and make a library using the NEBNext Ultra Directional RNA library kit for Illumina (NEB).
-
bioRxiv - Cancer Biology 2022Quote: ... mRNA enrichment and library preparation was performed using the NEBNext Poly(A) mRNA Magnetic Isolation Module and NEBNext Ultra II RNA Library Prep kit (NEB). Sequencing was done using the Illumina NextSeq500 to obtain >20 million 75bp single-end or 37bp paired-end reads per sample or at Genewiz (HiSeq ...
-
bioRxiv - Microbiology 2022Quote: ... 1μg of input RNA was used for RNA library preparation using the NEB Next Ultra II RNA Library Prep kit for Illumina (E7775L; NEB). Prepared libraries were quantified using real time PCR and bioanalyzer ...
-
bioRxiv - Genetics 2022Quote: ... We prepared the libraries with the NEBNext Ultra II FS DNA Library Prep Kit (New England Biolabs, Ipswich, Massachusetts, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... Small RNA-seq libraries were generated from the small RNA fraction by TCAG using NEBNext Small RNA Library Kit (New England BioLabs) according to the manufacturer’s protocol in two batches ...
-
bioRxiv - Cancer Biology 2022Quote: ... The L325R mutation was introduced to the EGFP-talin1 head construct using the Q5-site directed mutagenesis kit (NEB, E0554).
-
bioRxiv - Biochemistry 2022Quote: The mutant constructs used in this paper were prepared by point directed mutagenesis using the Q5 Site-Directed Mutagenesis Kit (NEB). Primers were designed and annealing temperatures determined using the NEBase Changer tool ...
-
bioRxiv - Developmental Biology 2022Quote: ... and integrated into a MluI-NheI site of pT2A-CAGGS (Urasaki et al., 2006) using a Gibson Assembly Kit (New England BioLabs). To obtain pT2A-CAGGS-PEmax-ires-ZsGreen1 ...
-
bioRxiv - Biochemistry 2022Quote: ... the serine residues S240 and S250 in Dsn1 were mutated to aspartic acid using the Q5 site-directed mutagenesis kit (New England Biolabs) as described previously 19,20 ...
-
bioRxiv - Biochemistry 2022Quote: We assembled mutant libraries by combining the linearized sensor backbone with each oligo subpool at a molar ratio of 1:5 using Golden Gate Assembly Kit (New England Biolabs; 37 °C for 5 min and 60 °C for 5 min ...
-
bioRxiv - Biochemistry 2022Quote: ... Site-directed mutagenesis to create the EcGhrAW45F variant was performed using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) using the mutagenic primers 5’-TGCTTTAGTCTTTCATCCTCCTG-3’ (forward ...
-
bioRxiv - Genetics 2022Quote: ... This pooled mixture was run on a 2% agarose gel and we extracted and purified DNA in the 400 bp to 600 bp region using the Monarch Gel Extraction Kit (NEB) according to the manufacturer’s instructions.
-
bioRxiv - Genetics 2022Quote: ... We used this synthetic HIS3 fragment and BsmBI-v2/HpaI-digested PFA0055 to create plasmid PFA0227 by isothermal assembly cloning using the HiFi Assembly Cloning Kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... All samples were processed in a single batch and the isolated mRNA from each sample was used to prepare RNA sequencing libraries using the NEBNext Ultra II Directional RNA Library Prep kit (NEB) according to the manufacturer’s instructions ...