Labshake search
Citations for New England Biolabs :
7501 - 7550 of 9366 citations for Rat Alanine Glyoxylate Aminotransferase AGXT ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: Total and nascent RNA libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB, E7760S) following the rRNA depleted RNA protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... The amplicon was purified with a Qiagen PCR purification kit and digested with the restriction enzymes KpnI and HindIII (NEB, UK), followed by ligation using T4 DNA ligase (Fermentas ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the next two fragments were inserted into resulting plasmid using NEBuilder®HiFi DNA Assembly Cloning Kit (New England Biolabs). Fragments were amplified with primers (Table S1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... from COLO205 cells was subjected to one-step RT-qPCR analysis using the Luna Universal One-Step RT-qPCR Kit (NEB, E3005S) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... The sequencing library was prepared using the NEB Next Ultra II DNA Library Prep Kit for Illumina (New England Biolabs, E7645). Paired-end ...
-
bioRxiv - Genomics 2020Quote: ... ~200 ng of gDNA was used for library preparation with the NEBNext DNA Ultra II Library Prep Kit (New England Biolabs # E7645S) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were purified with the oligonucleotide cleanup protocol as described in the Monarch PCR & DNA Cleanup Kit 5 µg user manual (NEB #T1030). Clean PCR products were sequenced using Sanger methods by Eton Biosciences (https://www.etonbio.com/ ...
-
bioRxiv - Genomics 2020Quote: ... Purified dsDNA templates were used as templates for T7 transcription reactions using HiScribe™ T7 High Yield RNA Synthesis Kit (NEB) and bio-16-CTP (Trilink ...
-
bioRxiv - Genomics 2020Quote: A total of 1.5 μg of gDNA was end-repaired (NEBnext ultra II end repair kit, New England Biolabs, MA, USA) and purified using 1x AmPure beads (Beckmann Coulter ...
-
bioRxiv - Genomics 2020Quote: Plasmids containing H2afz-FKBP.knock-in.BFP and Nelfb-Halo DNA repair templates were synthesized with long homology arms (∼800 bp) by Genewiz FragmentGene and assembled using the NEBuilder HiFi DNA Assembly Cloning kit (NEB E5520S). The Dendra2-RBP1 plasmid and guide were used as previously described10.
-
bioRxiv - Genomics 2020Quote: ... An Illumina-compatible library was then prepared from 400 ng input gDNA with an NEBNext Ultra™ II FS DNA Library Prep Kit for Illumina (New England Biolabs) with a total of four PCR cycles to introduce dual indexed barcodes ...
-
BET protein inhibition regulates macrophage chromatin accessibility and microbiota-dependent colitisbioRxiv - Immunology 2021Quote: ... Transposed DNA samples were purified using the Qiagen MinElute Kit (#28204) followed by amplification using 1x PCR master mix (NEB #M0541S) and 25 μM Ad1_noMX and Ad2.* indexing primer for 10-14 cycles ...
-
bioRxiv - Molecular Biology 2021Quote: TCF20(1-1268)-mEGFP construct was generated from the TCF20-mEGFP plasmid using the Q5 Side-Directed Mutagenesis Kit (NEB, E0554S) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the libraries have been generated using NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina® (NEB, USA). The libraries have been purified using the AMPure XP system ...
-
bioRxiv - Molecular Biology 2021Quote: ... were used as template of the in vitro transcription (HiScribe™ T7 Quick High Yield RNA Synthesis Kit, #E2050S, New England Biolabs), performed at 37°C for 16 hr ...
-
bioRxiv - Synthetic Biology 2019Quote: ... plasmids from 120 CFUs with different phenotypes were isolated with the Monarch®Plasmid Miniprep Kit (New England Biolabs, Ipswich, USA) and analyzed via Sanger-sequencing (Eurofins Genomics ...
-
bioRxiv - Neuroscience 2019Quote: ... RNA-Seq libraries (400 bp) were created using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760L). Samples were individually indexed using the NEBNext Multiplex Oligos for Illumina (NEB #E6609S) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Further purification to remove contaminated genomic DNA was performed using a Monarch Total RNA Miniprep Kit (New England Biolabs, MA, USA), according to the supplier’s protocol ...
-
bioRxiv - Developmental Biology 2020Quote: Libraries for DNA sequencing were prepared according to the instructions accompanying the NEBNext DNA Ultra II kit (catalog # E7645S; New England Biolabs, Inc). Libraries were sequenced on the NextSeq 500 following the manufacturer’s protocols ...
-
bioRxiv - Biochemistry 2019Quote: ... TR standards for northern blots were in vitro transcribed from PCR products using the HiScribe™ T7 high yield RNA synthesis kit (New England Biolabs). Band intensities were quantified using ImageQuant TL 8.2 (GE Healthcare Life Sciences).
-
bioRxiv - Molecular Biology 2019Quote: The purified PCR products were used as templates for in vitro transcription of antisense and sense ssRNA by using the HiScribe™ T7 In Vitro Transcription Kit (NEB #E2030S ...
-
bioRxiv - Molecular Biology 2020Quote: ... SpCas9 was amplified by PCR and the PCR product was assembled with a −8.7 kb backbone construct using NEBuilder® HiFi DNA Assembly Cloning Kit (New England Biolabs, USA) according to manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Modification of this gene was carried out by Gibson assembly using oligonucleotides sourced from Eurofins or using the Q5® Site-Directed Mutagenesis Kit from NEB. Designed apoproteins were expressed in E ...
-
bioRxiv - Genomics 2019Quote: ... DNA libraries were prepared at the Fundación Parque Científico de Madrid (FPCM) using NEBNext® Ultra™ II DNA Library Prep Kit for Illumina (New England Biolabs) and purified with Agencourt AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Plant Biology 2020Quote: ... Qualified RNA per sample was used to generate sequencing libraries by NEBNext Ultr RNA Library Prep Kit for Illumina (NEB, USA) following manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2019Quote: ... First strand cDNA synthesis was performed using an oligodT and the ProtoScript Taq RT-PCR kit (New England Biolabs, Ipswich, MA). Second strand synthesis was performed with the NEBNext mRNA Second Strand Synthesis Module kit – E6111S (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: Synthesis of cDNA was performed using NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England Biolabs; cat. no. E7420) according to manufacturer’s instruction ...
-
bioRxiv - Genomics 2019Quote: The Illumina paired-end adaptor was ligated to ∼500 ng purified sonicated AluI-digested DNA using the NEBNext Ultra DNA library kit for Illumina (New England Biolabs E7370) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... 40 ng of the fragmented DNA was used to make Illumina sequencing libraries with the NEB Next DNA library kit for Illumina (New England Biolabs, www.neb.com). For 3 samples (family 1 mother 10 month ...
-
bioRxiv - Genomics 2019Quote: ... Stranded RNAseq libraries were prepared from poly(A) selected RNA with the NEBNext Ultra RNA Library Prep Kit (NEB, Cambridge, MA) and sequenced across two Illumina HiSeq lanes ...
-
bioRxiv - Molecular Biology 2020Quote: ... The gRNAs targeting SERPINB5 and Tnf were created by site-directed mutagenesis of pLenti-Il33gRNA6-puro using primers listed in Supplementary Table S2 and the Q5® Site-Directed Mutagenesis Kit (NEB) according to manufacturer protocol ...
-
bioRxiv - Genomics 2019Quote: ... Sequencing adapters and oligonucleotides used for PCR barcoding were from the NEBNext Multiplex Oligos for Illumina Kit (New England Biolabs, NEB). Prior to PCR amplification of the library ...
-
bioRxiv - Zoology 2019Quote: ... The libraries were synthesized using NEBNext Ultra Directional RNA Library Prep Kit for Illumina (E7760, New England BioLabs, Ipswich, Massachusetts, USA). Paired-end sequencing was carried out using Illumina HiSeq 2500 instrument (Illumina ...
-
bioRxiv - Genomics 2019Quote: ... The annealed oligos were used as the templates for in vitro transcription (IVT) using the HiScribe™ T7 High Yield RNA Synthesis Kit (Cat. E2040S, NEB). After IVT ...
-
bioRxiv - Immunology 2019Quote: IVT was performed using the T7 promoter of the pcDNA3.3_NDG plasmid and HiScribe T7 ARCA mRNA kit with tailing (NEB #E2060S, Ipswich, MA). Whole kit was used with 20 ug DNA following manufacturer’s protocol ...
-
CHC22 clathrin mediates traffic from early secretory compartments for human GLUT4 pathway biogenesisbioRxiv - Cell Biology 2019Quote: ... The haemagglutinin (HA-)tag sequence atcgattatccttatgatgttcctgattatgctgag was inserted at base pair 201 (between amino acids 67 and 68 of the exofacial loop of GLUT1) using the Q5 site-directed mutagenesis kit from New England Biolabs (NEB, USA). HA-GLUT4 and HA-GLUT1 were extracted using AcsI and EcoRI restriction enzymes and Cutsmart buffer from NEB and the agarose gel extraction kit from Qiagen ...
-
bioRxiv - Microbiology 2019Quote: ... These fragments were cloned into the XhoI site of pACYCDuet-1 by a NEBuilder HiFi DNA Assembly kit (New England Biolabs, USA), resulting in the plasmid pEXT06 ...
-
bioRxiv - Microbiology 2019Quote: ... These three PCR products were assembled with a double digested pUC19 (PstI and EcoRI) using a NEBuilder HiFi DNA Assembly kit (New England Biolabs, USA), which resulted in the vector pEXT01 ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The recoded gene was then synthesized ab initio by Twist Biosciences and assembled into pSB1C3-T7 using the NEB HiFi Assembly kit (NEB# E5520S).
-
bioRxiv - Cancer Biology 2019Quote: ... Paired end strand-specific whole transcriptome libraries were prepared for 16 pairs using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England BioLabs, UK), following rRNA depletion with NEBNext rRNA Depletion Kit or Ribo-Zero Gold ...
-
bioRxiv - Molecular Biology 2020Quote: ... Two gRNAs targeting the second and the last exon of spel1 were cloned with the Gibson Assembly® Cloning Kit (New England Biolabs) into a BbsI (10,000 units/ml ...
-
bioRxiv - Molecular Biology 2019Quote: ... EcoR1 and Kpn1) right after SV40 promoter and immediately before firefly Luc using Q5® Site-Directed Mutagenesis Kit (NEB BioLabs) according to the manufacturer protocol.
-
bioRxiv - Molecular Biology 2019Quote: ... EcoR1 and Kpn1) right after SV40 promoter and immediately before firefly Luc using Q5® Site-Directed Mutagenesis Kit (NEB BioLabs) according to the manufacturer protocol.
-
bioRxiv - Cancer Biology 2019Quote: ... Up to 10 ng of cDNA was used for the Illumina sequencing library construction using NEBNext Ultra DNA Library Prep Kit (NEB, E7645). Paired ends sequencing was performed on NextSeq 500 (Illumina ...
-
bioRxiv - Cancer Biology 2019Quote: ... Up to 10 ng of DNA was used for the library construction using NEBNext Ultra II DNA Library Prep Kit (NEB, E7645). Sequencing was performed on NextSeq500 (Illumina ...
-
bioRxiv - Microbiology 2019Quote: Site-directed mutagenesis of the fHbp SP in pGCC4fHbpL91543 to repair SNP1 and SNP2 individually was performed using the Q5® Site-Directed Mutagenesis Kit (NEB) according to the manufacturer’s recommendations ...
-
bioRxiv - Genetics 2019Quote: ... ErCas12a Strataclone was subjected to site directed mutagenesis with ErCas12a SDM remove BsaI Top and ErCas12a SDM remove BsaI bottom with the Q5 SDM kit (New England Biolabs #E0554S) to generate ErCas12a Strataclone no BsaI ...
-
bioRxiv - Biochemistry 2020Quote: Mutated variants of AtXOAT1 were generated by site-directed mutagenesis using the Q5® Site-Directed Mutagenesis Kit (New England Biolabs) according to the manufacturer’s instructions using pGEN2-DEST-AtXOAT1 as a template ...
-
bioRxiv - Biochemistry 2019Quote: RNA was produced by in vitro transcription (IVT) using the HiScribe T7 High Yield RNA Synthesis Kit (New England BioLabs, E2040S). DNA templates for the IVT reaction were produced by annealing complementary DNA oligos (IDT ...
-
bioRxiv - Genetics 2019Quote: ... The Mod5MTS-M12A-TRIT1 construct was generated by site directed mutagenesis using the Q5® Site-Directed Mutagenesis kit (New England Biolabs) and Mod5MTS-TRIT1 and forward and reverse primers ...