Labshake search
Citations for New England Biolabs :
701 - 750 of 1704 citations for Potassium 3 4 difluorophenyl trifluoroborate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... to 3’-P presenting in the RNA that was dephosphorylated using T4 PNK (NEB, #M0201S). Linker and RNA ligation was performed by ligating pre-adenylated linker to the 3’-OH of RNA using RNA ligase2 ...
-
bioRxiv - Genomics 2021Quote: ... The 3′ adapter (sequence: AGATCG-GAAGAGCACACGTCTGAACTC) was ligated using T4 RNA Ligase 1 (NEB, M0204L) and purified nascent RNA using streptavidin beads (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: 3’ linker ligation (1x PNK buffer, 800 u T4 RNA ligase 2 truncated KQ (NEB), 80 u RNaseOUT ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 2.0 units of Klenow Fragment (3’-5’ exo−)(New England Biolabs, Ipswich, Massachusetts, USA), total 10 μl of the mixture was incubate at 37°C for 90 min ...
-
bioRxiv - Genomics 2023Quote: ... followed by 23.5 μl of ligation mix (3 μl 1x T4 ligase buffer (NEB, B0202S), 0.15 μl 50 mg/ml BSA (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... samples were incubated with 1.5 µl EndoH and 2 µl 10× GlycoBuffer 3 (all NEB) buffer at 37°C 1h ...
-
bioRxiv - Molecular Biology 2023Quote: ... Small RNAs were 3’ dephosphorylated and 5’ phosphorylated with T4 polynucleotide kinase (T4PNK, NEB, #M0201S), and purified with RNA Clean and Concentrator-5 (Zymo Research ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and second strand cDNA synthesis (using Klenow fragment 3’-5’ exo- [New England BioLabs, USA]) of chicken fecal samples and dust samples was performed as previously described 55 and following manufacturer’ instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... 3 μg purified DARPP-32 isoforms as well as 5 μl ATP (New England Biolabs) in kinase dilution buffer III (SignalChem ...
-
bioRxiv - Cell Biology 2022Quote: ... A18-Y260A-SDM-Rev (5’-CGTTGTGTAACCAGGAGAATG-3’) and Q5 site directed mutagenesis kit (NEB E0554). This LT3N1-GPIR-Arhgef18 vectors were further modified to substitute EGFP with 3XHA-FLAG tag ...
-
bioRxiv - Cell Biology 2022Quote: ... miRE-Rv (5’-TCTCGAATTCTAGCCCCTTGAAGTCCGAGGCAGTAGGC-3’) and Q5 Hot Start High-Fidelity DNA polymerase (NEB M049S). The final amplicon was then digested and cloned into LT3GEPIR in-between XhoI and EcoRI restriction sites as previously described2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The 3×HA-DHFR cassette was amplified from the resulting vector by Q5 polymerase (NEB) using primers containing a 50 nt overlap homologous to the either upstream or downstream regions of the TGRH88_003980_t1 stop codon (primers “flank fwd Tgurpl11m tagging” and “flank rev Tgurpl11m tagging” in table S9 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1pmol ssDNA substrate 5’ DY782 ATTATTATTATTATTATTATTTCATTTATTTATTTATTTA-3’ (Eurofins, UK) and 0.75U uracil-DNA glycosylase (NEB) were added to 10µg protein lysate at 37°C for 1 hour ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified fragments were dephosphorylated at their 3′ ends with T4 polynucleotide kinase (New England Biolabs) at 37 °C for 1 h and ligated to a 3′ adaptor sequence using T4 RNA ligase 2 (truncated K227Q ...
-
bioRxiv - Microbiology 2023Quote: ... Nef deletion Reverse: 5’-AGATCTACAGCTGCCTTGTAAGTCATTGG-3’) using Q5® Site-Directed Mutagenesis Kit (NEB #E0554S).
-
bioRxiv - Microbiology 2023Quote: ... The 3 fragments were ligated using the Gibson Assembly® Cloning Kit (New England Biolabs). The created pEXG2::ΔfahA and pEXG2::ΔpanC were transformed into E ...
-
bioRxiv - Microbiology 2024Quote: ... the pUC19-PRha-YFP-3×FLAG plasmid was inverse amplified by PCR (Q5 polymerase, NEB), omitting the yfp gene ...
-
bioRxiv - Cancer Biology 2023Quote: Equal number (3×106) of cells were harvested in ice-cold nuclear extraction buffer (NEB) (400 μl ...
-
bioRxiv - Microbiology 2023Quote: ... The vigR 3’ UTR sequence was amplified from JKD6009 using Phusion Hot Start Polymerase (NEB) with primers incorporating the MS2 aptamer sequence (fused to 5’ end of vigR 3’ UTR ...
-
bioRxiv - Molecular Biology 2024Quote: ... A second adapter was then ligated to the 3’OH of the cDNAs (with NEB HC RNA Ligase in NEB ligation buffer plus 5% DMSO ...
-
bioRxiv - Molecular Biology 2024Quote: The biotin-enriched eluate was next subjected to 3’end dephosphorylation using PNK (M0201L, NEB) and FastAP (EF0654 ...
-
bioRxiv - Immunology 2024Quote: ... and 0.8U/µL of Klenow Fragment (3’-5’ exo-) DNA polymerase (NEB, Cat No. M0212M). Nickase induced linear SDA was performed using 3nM (0.04U/ µL ...
-
bioRxiv - Microbiology 2024Quote: ... The 3 fragments were assembled using Gibson assembly (NEBuilder HiFi DNA Assembly Master Mix, NEB). To re-introduce the proBA operon (now with A319G ...
-
bioRxiv - Genomics 2024Quote: ... the 3’ end of RNA fragments was dephosphorylated with FastAP (Thermo) and T4 PNK (NEB), followed by 5’ end phosphorylation of cleaved target RNAs with T4 polynucleotide kinase (PNK ...
-
bioRxiv - Biochemistry 2024Quote: ... and 2,000 nM Rad51 were incubated with 3 μM nt ϕX174 ssDNA (5,386 nt; NEB) in buffer containing 2 mM nucleotide (where indicated) ...
-
bioRxiv - Biochemistry 2024Quote: ... In short 5’-phosphorylated and 3’-OH RNA was circularized with RNA ligase 1 (NEB) followed by denaturing PAGE purification as described above ...
-
bioRxiv - Neuroscience 2024Quote: The 3 DNA fragments were fused using the Gibson Assembly Cloning kit (New England Biolabs) and subcloned into the pCR2.1-TOPO vector (Invitrogen) ...
-
bioRxiv - Systems Biology 2024Quote: ... and NEBNext Multiplex Oligos for Illumina Index Primers Set 1 and 3 (NEB E7335S, E7710S) and PCR-amplified for 15 cycles ...
-
bioRxiv - Genomics 2024Quote: ... to 3’-P presenting in the RNA that was dephosphorylated using T4 PNK (NEB, #M0201S). Linker and RNA ligation was performed by ligating pre-adenylated linker to the 3’-OH of RNA using RNA ligase2 ...
-
bioRxiv - Developmental Biology 2024Quote: ... custom NTP mix was prepared with 3’-O-Me-m7G cap analogue (60 mM, NEB), GTP (75mM ...
-
bioRxiv - Microbiology 2020Quote: ... incubated overnight at 4°C and treated with DNAse I (New England Biolabs) at 37°C for 60 minutes ...
-
bioRxiv - Genomics 2020Quote: ... and then held at 4°C until a subsequent T7 Endonuclease I (NEB) treatment at 37°C for 30 to 90 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... 15 µL of labeling mix (4 µL 10X ThermoPol Reaction buffer (NEB, B9004S), 2 µL of 5 mM aa-dUTP/dNTP mix (5 mM each dATP ...
-
bioRxiv - Bioengineering 2021Quote: ... (4) lacI and tac promoter from pMAL-c5X (New England Biolabs, Ipswich, MA). The modified replacement plasmid for pMut2 ...
-
bioRxiv - Physiology 2021Quote: ... Mutations in hSlo1 and β1/4 were introduced by PCR-mediated mutagenesis (NEB) using oligonucleotide primers (IDT ...
-
bioRxiv - Biochemistry 2021Quote: ... 4% Glycerol and 0.1 mM DTT) with 75 µM S-Adenosylmethionine (SAM, NEB), varying amounts ssRNA and duplex RNA (see above) ...
-
bioRxiv - Genomics 2023Quote: ... The DGP-4 fragments were then cloned into the AscI/NheI (NEB, USA) site of the p200 vector to construct the sgRNA library (p200 library ...
-
bioRxiv - Molecular Biology 2022Quote: ... was mixed with 7.1 μl H2O and 0.9 μl NEB 4 buffer (NEB). After incubating for 10 min at 96°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 6 and 4 μL of 6× Gel Loading Dye (B7025S, New England Biolabs) and 1.5 and 1 μL of 2.5 mg/mL EtBr were added ...
-
bioRxiv - Cell Biology 2023Quote: ... Adapter-ligated DNA was digested with 4 µL of EcoRV-HF (NEB, R3195), incubated at 37 °C for 30 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... The gel fragments were incubated with 4 mg/mL proteinase K (NEB, P8107) in PK buffer (100 mM Tris-HCl ...
-
bioRxiv - Biochemistry 2023Quote: ... 4 U/mL creatine kinase) containing 10 µMnt cssDNA (NEB, PhiX virion DNA) was supplemented with Rad51 (5 µM ...
-
bioRxiv - Bioengineering 2023Quote: ... 4 ng gBlock template and 1 Unit Phusion High-Fidelity DNA polymerase (NEB). The reaction was subjected to a 2-minute initial denaturation at 98 °C ...
-
bioRxiv - Biophysics 2024Quote: ... the product was digested by Dpn1 for 4 hours (New England Biotechnologies, NEB). The PCR product was purified by gel purification (Zymo Research) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 µl of T4 DNA polymerase (3,000 U/ml, NEB, cat. no. M0203S) and 1 µl of the DNA polymerase I large (Klenow ...
-
bioRxiv - Biochemistry 2024Quote: ... 4 picomoles of hybridized DNA were mixed with USER3 mix (New England Biolabs) in ThermoPol buffer (20 mM Tris-HCl pH 8.8 ...
-
bioRxiv - Cancer Biology 2021Quote: ... or a polyclonal rabbit antibody against cleaved casp-3 (1:100; New England Biolabs, Frankfurt, Germany), followed by a biotinylated goat anti-rabbit secondary antibody (Abcam ...
-
bioRxiv - Genomics 2020Quote: ... 1 μL of 10 mM dATP and 15 units of Klenow 3’ → 5’ exo- (NEB M0212L) was added to blunted ends and incubated at 37°C for 30 minutes ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3 µl were used for amplification with Taq 2X Master Mix (New England Biolabs, Ipswitch, USA) using a 20-cycles PCR protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Products were then ligated to 3’ adaptor (/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/) by T4 RNA ligase 2(NEB) and 5’ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCr-GrArCrGrArUrCrNrNrNrCrGrArNrNrNrUrArCrNrNrN ...