Labshake search
Citations for New England Biolabs :
701 - 750 of 6722 citations for N 5 Trimethoxysilyl 2 Aza 1 Oxopentyl Caprolactam since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... NEB 5-alpha competent E.coli (NEB) were transformed by ligated productions using manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: 5-alpha competent cells (NEB C2987H)
-
bioRxiv - Biophysics 2024Quote: ... NEB 5-ɑ (New England Biolabs) and BL21 (DE3 ...
-
bioRxiv - Genomics 2024Quote: ... 5 μl 10x rCutSmart buffer (NEB) in a total volume of 50 μl and incubated for 15 min at 65 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... or NEB 5-alpha HE (NEB) E ...
-
bioRxiv - Genetics 2024Quote: ... 5 μl proteinase K (NEB, P8107) was added and the sample was mixed by pipetting ...
-
bioRxiv - Developmental Biology 2020Quote: ... oligonucleotides for the HAS-1 or HAS-2 sgRNA guide sequences were phosphorylated using T4 PNK (NEB, Ipswich, MA) for 30 min at 37°C ...
-
Nonsense Mediated RNA Decay Is a Unique Vulnerability of Cancer Cells with SF3B1 and U2AF1 MutationsbioRxiv - Cell Biology 2021Quote: ... Genomic DNA (2 μg) was then treated with buffer alone or with 1 unit RNase H enzyme (NEB, MO297S) for 2 hours at 37 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... were assembled using 10 μl of 2× master mix at 50 °C for 1 h according to manufacturer’s instructions (NEB). 5α Competent Escherichia coli (30 μl ...
-
bioRxiv - Microbiology 2022Quote: ... the cap-1 structure was added using the vaccinia virus capping enzyme and 2 -O-methyltransferase (New England Biolabs). The mRNA was purified by oligo-dT affinity purification ...
-
bioRxiv - Molecular Biology 2022Quote: ... doner RNA and the complementary splint DNA strand were annealed at a molar ratio of 1: 2: 1.5 in T4 DNA ligase buffer (NEB) by incubation for 3 min at 65°C ...
-
bioRxiv - Neuroscience 2022Quote: ... RNP complex were generated by mixing 1 μg of sgRNA with 2 μM of EnGen SpyCas9 NLS (NEB, M0646) at room temperature for 15-20 min ...
-
bioRxiv - Microbiology 2022Quote: ... the cap-1 structure was added using the vaccinia virus capping enzyme and 2’-O-methyltransferase (New England Biolabs). The mRNA was purified by oligo-dT affinity purification ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.01 pmol (2:1 molar ratio of insert:backbone) library and 2.5 uL NEBuilder HiFi DNA Assembly Master Mix (NEB E2621) and incubated at 50 °C for 60 minutes ...
-
bioRxiv - Biochemistry 2023Quote: IVT and co-transcriptional capping reactions were performed in 30 μL reactions containing 1x T7 RNA polymerase buffer (40 mM Tris-HCl, 20 mM MgCl2, 1 mM DTT, 2 mM spermidine, pH 7.9; New England Biolabs), 5 mM each NTPs ...
-
bioRxiv - Molecular Biology 2023Quote: ... Barcoded 3’ adapters (see Extended Data Table 1) were ligated using K227Q truncated T4 RNA ligase 2 (NEB, M0351L) at a concentration of 0.5 µM adapter and in the presence of 25% PEG8000 containing a homemade 10 x ligation buffer (0.5 M Tris pH 7.8 ...
-
bioRxiv - Neuroscience 2023Quote: ... mRNA Magnetic Isolation Module and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1/2/3/4) following the manufacturer’s instructions (New England Biolabs). Quantification and quality checked of libraries was done using an Bioanalyzer 2100 instrument and DNA 7500 kit (Agilent Technologies) ...
-
bioRxiv - Microbiology 2023Quote: ... by mixing 2 ul 1:10.000 diluted library with 8 ul Quant mastermix with added primers (New England Biolabs). Due to low initial concentration of adapter ligated product we made triplicates of the library ...
-
bioRxiv - Microbiology 2024Quote: ... and assembled with NEBuilder Hifi DNA assembly master mix at a 2:1 molar ratio (New England Biolabs #E5520S) following manufacturer’s instructions.
-
bioRxiv - Immunology 2021Quote: ... Samples were added to second-strand synthesis mix containing 2× NEB buffer 2 (NEB), 625 nM dNTP Mixture (NEB) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 50 ng PCR product was incubated with 2 µL 10X NEBuffer 2 (NEB, B7002S) and nuclease-free water adding up to 19 µL using the following program ...
-
bioRxiv - Molecular Biology 2021Quote: An RNA oligonucleotide (5’-GGCATGTGATTGGTGGGTC) was 5’ labelled with gamma 32P ATP by T4 Polynucleotide Kinase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... 5% CO2 -balanced complete cell culture medium with 5 μM SNAP-Surface Alexa Fluor 647 (NEB, S9136S), for 15 minutes at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... or 120 μM m7G(5’)ppp(5’)G RNA Cap Structure Analog (M7; New England BioLabs #S1404S) was used ...
-
bioRxiv - Genomics 2024Quote: ... the 5’-end of nascent RNAs was decapped on-beads in RNA 5’ Pyrophosphorylase mix (NEB, M0356S) at 37 °C for 45 min ...
-
bioRxiv - Synthetic Biology 2024Quote: G(5’)ppp(5’)A RNA Cap Structure Analog (New England Biolabs Japan Inc., Tokyo, Japan, #S1406)
-
bioRxiv - Microbiology 2024Quote: ... the RNA was ligated to the 5′-universal RNA adapter (5′GAUAUGCGCGAAUUCCUGUAGAACGAACACUAGAAGAAA3′) using T4 RNA ligase (NEB). After extraction with 25:24:1 phenol/chloroform/isoamyl alcohol and ethanol precipitation ...
-
bioRxiv - Evolutionary Biology 2021Quote: 5’ phosphorylation was performed by mixing 6 uL of rRNA depleted RNA with 1 uL of 10X PNK buffer (NEB B0201S), 1 uL of PNK enzyme (NEB M0236S) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Adaptor ligated RNAs 48-58nt long (corresponding to 19-29nt long input RNAs) were extracted and ligated to the 5’ adaptor using T4 RNA Ligase 1 (NEB, M0204). A total of ten variable nucleotides (unique molecular identifiers ...
-
bioRxiv - Genomics 2021Quote: ... 0.5 µg of the treated RNA was used for ligation to an RNA oligonucleotide with T4 RNA ligase 1 (NEB M0204) for 1 hr at 25 °C then converted to first strand cDNA with random priming and the ProtoScript II reverse transcriptase mix (NEB E6560) ...
-
bioRxiv - Systems Biology 2020Quote: ... 10 mM DTT, 12% PEG 8000, 1 mM each dNTPs, 10 µM dN-SMRT oligo, 5 µl Klenow enzyme NEB #M0212) for 1 h at 37 °C ...
-
bioRxiv - Genomics 2022Quote: ... Biotin-labeled DNA fragments captured on beads were ligated to multiplexing adaptors by adding 5 μL each adapter (50 μM) and 1 μL T7 DNA ligase (NEB, M0318L) in 100 μL ligation mixture and incubating at room temperature for 1 hour with rotation ...
-
bioRxiv - Biochemistry 2021Quote: ... at 37 °C for 1 hour or first with 5 units T4 Polynucleotide Kinase with 25 mM ATP in 1 X T4 Kinase buffer (T4PNK, NEB, M0236S) at 37 °C for 30 min and then with XRN-1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... the cells were washed 3 times with PBS and permeabilized 5 min on ice with permeabilize sol (1xPBS, 1%RNAse inhibitor Ribovanadylcomplex (RVC, NEB,#S1402S), 0,5 % Triton X-100 (Sigma ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 5’ ends of RNA fragments were phosphorylated by T4 PNK and ligated to 5’ adaptor (CGATCTCCAATTCCCACTCCTTTCAAGACCTrC) using T4 RNA Ligase 1 (NEB, M0437M). Ribosomal RNA (rRNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1/20th of the annealed substrates was 5′-end-labelled with [γ-32P]-ATP and T4 polynucleotide kinase (New England Biolabs). For fluorescently labeled HJ40 substrates ...
-
bioRxiv - Plant Biology 2023Quote: ... 500 ng of RCA amplicons were treated with T7 endonuclease 5 μL of 10× reaction buffer and 1 μL of T7 endonuclease I (New England Biolabs, M0302S) in a 50 μL reaction volume ...
-
bioRxiv - Developmental Biology 2023Quote: ... the coding sequence of alg-1 was amplified from genomic DNA using PCR and primers 5’- acaaggacgacgacgacaagatggaagaccaatggttgct-3’ and 3’- cagttggaattctacgaatgttaagcaaagtacatgacgttgttggc-5’ and the coding sequence of mKate::3xFLAG was amplified from a plasmid containing mKate::3xFLAG using PCR and primers 5’-cggcatcgacgacgacgacgatggtttccgagttgatcaagg-3’ and 3’- cttgtcgtcgtcgtccttgtagtcgatAtcgtggtccttgtagtcaccgtcgtggtccttgtagtccttacgatgtccgagcttgg-5’ and the vector containing rgef-1p and unc-54 3’UTR was amplified from plasmid rgef-1p::aak-2::unc-54 3’UTR using PCR and primers 5’-cattcgtagaattccaactgagc-3’ and 3’-cgtcgtcgtcgtcgatgc-5’ were used to generate rgef-1p::mKate::3xFLAG::alg-1 by using Gibson assembly (NEB E2611). To generate a DNA plasmid containing rgef-1p::mKate::3xFLAG::alg-2 ...
-
bioRxiv - Immunology 2023Quote: ... The digested and purified inset and vector were ligated at a ratio of 5:1 using T4 DNA ligase (NEB, M0202) overnight at 18°C ...
-
bioRxiv - Genomics 2023Quote: ... The pellet was resuspended in 90 µL of freshly prepared Micro-C “Master Mix 1” (10 μl 10x T4 DNA Ligase Buffer, 75 μl ddH2O, 5 μl T4 PNK (NEB #M0201L)) ...
-
bioRxiv - Genetics 2023Quote: ... 600 ng linearized plasmid backbone and 48 ng of digested library (molar ratio of 1:3) were ligated with 5 μL (2000 U) of T4 DNA ligase (NEB M0202S) in a 100 μL reaction ...
-
bioRxiv - Biochemistry 2024Quote: ... Samples were diluted at a 1:5 ratio with H2O prior to qPCR using Luna Universal qPCR Master Mix (New England Biolabs, #M3003) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 units DNase I (NEB), or both for 30 min at 37 °C ...
-
bioRxiv - Immunology 2021Quote: ... α2-3,6,8,9 neuraminidase A (NEB), LB Broth (BD Difco™) ...
-
bioRxiv - Microbiology 2020Quote: ... 2) NEB Q5 (NEB M0491), 3 ...
-
bioRxiv - Molecular Biology 2022Quote: ... T4 RNA ligase 2 (NEB) and RiboLock RNase inhibitor (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... 2 U DNase I (NEB) was added to IVT mixture and further incubated at 37 °C for 30 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 units DNase I (NEB), or both for 1 h at 37°C and resolved on a denaturing urea polyacrylamide gel (20% ...
-
bioRxiv - Microbiology 2021Quote: ... in 1x NEBuffer 2 (NEB) at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl Proteinase K (NEB) was added and samples were incubated at 56°C for 1 hour ...