Labshake search
Citations for New England Biolabs :
701 - 750 of 9435 citations for Human Lysine K Specific Demethylase 1A KDM1A ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... with short homologies for Gibson assembly and cloned into human IgG1 or human IgL2 expression vectors using the NEB Hifi DNA Assembly mix (NEB, Cat#E2621L). Plasmid sequences were verified by Sanger sequencing (Genewiz).
-
The conserved metalloprotease invadolysin is present in invertebrate haemolymph and vertebrate bloodbioRxiv - Cell Biology 2019Quote: ... Human plasma was treated with PNGase F (NEB; P0704S) or a mixture of O-Glycosidase (NEB ...
-
bioRxiv - Biophysics 2020Quote: ... as with commercially available human H1 (hH1) (M2501S; NEB), sharing 96.5% identity with mH1 (Fig ...
-
bioRxiv - Biochemistry 2023Quote: ... and human casein kinase II (New England BioLabs, #P6010).
-
A crucial role for dynamic expression of components encoding the negative arm of the circadian clockbioRxiv - Biochemistry 2023Quote: ... Recombinant human Histone H2A (New England BioLabs, Catalog # M2502S) or H4 (New England BioLabs ...
-
bioRxiv - Plant Biology 2021Quote: ... Immunoprecipitation experiments were performed with 15 μL of Pan anti-glycine lysine antibody conjugated to agarose beads (PTM Biolabs, Chicago, IL, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 mg of cell lysate was cleared with protein A magnetic beads to remove non-specific interactions (S1425S, NEB) and incubated overnight with anti-ZAP antibody (Proteintech 16820-1-AP ...
-
bioRxiv - Plant Biology 2020Quote: ... The region of interest was amplified with specific primers (see Supplemental Table 4) and the Q5 DNA polymerase (NEB), and indexed by PCR using primers containing Illumina indexes (see Supplemental Table 4) ...
-
bioRxiv - Cell Biology 2020Quote: ... Tagmentation reactions were completely used as input for a first PCR reaction with cassette-and Tn5-adapter-specific primers (5Btn-hmNeong.rv, P5.fw) with NEBNext Q5 HotStart polymerase (New England BioLabs) with 15 cycles of 68 °C and 1 min elongation ...
-
bioRxiv - Cell Biology 2020Quote: ... These beads were then used as input of a second PCR with cassette-and Tn5-adapter-specific primers (P7-gri701…706-hmNeong.rv, P5.fw) with NEBNext Q5 HotStart polymerase (New England BioLabs) with 25 cycles of 68 °C and 1 min elongation ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA across the samples was normalised and specific transcripts amplified using Phusion® high-fidelity PCR master mix (NEB) with primers outlined in Supplemental Table S2 ...
-
bioRxiv - Neuroscience 2019Quote: Enhancers were cloned from C57Bl/6J genomic DNA using enhancer-specific primers and Phusion high-fidelity polymerase (M0530S; NEB). Individual enhancers were then inserted into an rAAV or scAAV backbone that contained a minimal beta-globin promoter ...
-
bioRxiv - Genomics 2020Quote: ... Locus-specific PCR was performed using the standard protocol for Q5 Hot Start Master Mix (New England BioLabs M094S). PCR was also performed on unedited DNA extracted from PGP1 iPSCs as a control for background.
-
bioRxiv - Synthetic Biology 2020Quote: All plasmids used in this study were assembled by USER™ (uracil-specific excision reagent) cloning (New England Biolabs). Biobricks constituting promoters ...
-
bioRxiv - Immunology 2020Quote: ... Ighγ1 heavy-chain sequences were amplified in a nested PCR using primers for the Ighγ1 constant region together with a specific primer for VH186.2 (Mayer et al., 2017)(Table S1) and using high-fidelity Q5 polymerase (NEB). Amplified products were cloned (CloneJET PCR Cloning Kit ...
-
bioRxiv - Synthetic Biology 2022Quote: ... containing the T7 promoter and terminator were amplified using the specific primers (0.25 μM or 0.5 μM) and Phusion® DNA polymerase (NEB). The amplification program was ...
-
bioRxiv - Systems Biology 2022Quote: ... Restriction digestion was done using specific restriction enzymes BamHI and Hind III (0.5 U final concentration) and 1x cut smart reaction buffer (NEB) incubated in the water bath at 37 °C for 2 hours and 15 minutes respectively followed by heat inactivation for 15-20 minutes ...
-
bioRxiv - Systems Biology 2023Quote: ... A pcDNA3.4 backbone was amplified with specific primers (Fw: GGTAAGCCTATCCCTAACCCTCT, Rv: AGGCGATCTGACGGTTCAC) using NEBNext Ultra II Q5 HotStart (NEB). The library insert and linearized backbone were assembled using the NEBuilder HiFi DNA assembly master mix and half of the reaction volume was transformed by electroporation into 100µL of NEB 10-beta electrocompetent E ...
-
bioRxiv - Biochemistry 2024Quote: ... appropriate fragment of SynPOR gene was amplified with specific primers with additional fragments corresponding to amplified pET15b_AtPORB (Table S2) with Q5 polymerase (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... samples were gently removed from the chamber and digested overnight at 37°C in 8 U mL-1 proteinase K (NEB, cat# P8107) in digestion buffer (1× TAE buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... was immersed in a 10-fold volume of digestion solution with 8 U/mL Proteinase K (P8107S, New England Biolabs, Ipswich, USA) in digestion buffer containing 50 mM Tris pH 8.0 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Samples were treated with RNAse (100 μg/ml) at room temperature for 15 min and then with proteinase K (825 μg/ml, NEB™, P8107S) for 1 hour at 65°C ...
-
bioRxiv - Biochemistry 2020Quote: 1 μg of human recombinant histone H4 (BioLabs, Cat# M2504S) was incubated with 50 μM n-butyryl- or isobutyryl-CoA and 0.2 μM of HAT1 at 30 °C for 1 hour ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was prepared from total RNA using the rflP specific primer (P-LCM621) and template-switching oligonucleotide (P-LCM619) using RT Template Switching Enzyme Mix (New England Biolabs). The 5’-end end of the rflP cDNA was enriched by PCR using the primers P-LCM620 and P-LCM622 ...
-
bioRxiv - Microbiology 2019Quote: ... were amplified from genomic Synechocystis 6803 wild type DNA using specific primers (Table S1) and Phusion Polymerase (New England Biolabs). After restriction digest with BamHI and NotI ...
-
bioRxiv - Systems Biology 2020Quote: ... After chemical fragmentation by incubating for 15 min at 94°C the sample was directly subjected to the workflow for strand specific RNA-Seq library preparation (Ultra Directional RNA Library Prep, NEB). For ligation custom adapters were (Supplementary Table 6) ...
-
bioRxiv - Microbiology 2019Quote: ... RNA specific to the DWV clones were produced in vitro with T7 RNA polymerase (HiScribe T7 RNA polymerase, New England Biolabs) using as the templates PCR fragments corresponding to the positions 1242-1524 of the clones DWV-304 and DWV-422 (GenBank accession numbers MG831200 and MG831202 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Riboprobe templates were synthesized from cDNA via standard PCR using opsin specific primers (Table S1) and Q5 High Fidelity DNA polymerase (New England Biolabs). Primers were designed to bind to the coding sequence of target opsins (SWS2B ...
-
bioRxiv - Neuroscience 2020Quote: ... A combined restriction digestion and ligation reaction was performed to insert the annealed oligos behind the U6 promoter of the gene-specific GS-gRNA vector using SapI (NEB) and T4 DNA ligase (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... Heavy and light chain sequences were amplified with primers specific for the TSO handle-sequence and the respective constant region sequence with Q5 Polymerase (New England Biolabs). Following Sanger sequencing ...
-
bioRxiv - Molecular Biology 2020Quote: ... and then ligated to pre-annealed double-stranded adaptors that contain single dT overhangs and a unique molecular identifier (UMI) consisting of a randomized 8-base sequence containing a 3-base specific barcode by T4 DNA ligase (NEB) overnight at 15 °C ...
-
bioRxiv - Microbiology 2022Quote: ... and SLC35A1 were amplified using PCR with specific primers and cloned into the pS lentiviral vector [38] using NEBuilder (New England Biolabs).
-
bioRxiv - Microbiology 2022Quote: ... was performed using specific primers containing a 5’ T7 promotor sequence adapted to both forward and reverse primers and Taq polymerase (NEB). PCR products were purified using the GeneJET PCR Purification kit (Thermo Scientific ...
-
bioRxiv - Genetics 2022Quote: ... total RNA was reverse transcribed using a primer specific for library mRNA (TE121) and the Protoscript II reverse transcriptase (NEB). Following reverse transcription ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The splicing isoforms were then amplified with minigene-specific primers (F: CTGGCTAACTAGAGAACCCACTGC; R: GGCAACTAGAAGGCACAGTCG) and 32P-labeled dCTP using Q5 High-Fidelity DNA Polymerase (New England Biolabs) following the manufacturer′s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: Gene-specific primers (Supplementary Table 4) were labeled with [γ-32P]ATP by phage T4 polynucleotide kinase (New England Biolabs), as recommended by the manufacturer ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were then directly subjected to the workflow for strand-specific RNA-Seq library preparation (Ultra II Directional RNA Library Prep, NEB). For ligation custom adaptors were used (Adaptor-Oligo 1 ...
-
bioRxiv - Systems Biology 2022Quote: ... a partial Illumina Read1 sequencing adapter containing a plate-specific barcode was single-strand ligated using T4 RNA ligase I (NEB) and the product was reverse-transcribed ...
-
bioRxiv - Genomics 2019Quote: The degenerate barcoded plasmid was used as template for PCR using primers containing gene-specific targeting homology arms (1× NEB Q5 Master Mix #M0494S ...
-
bioRxiv - Molecular Biology 2019Quote: ... Each of the libraries was labeled by a specific barcode provided in NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) (NEB) and amplified 7 cycles by PCR in the presence of SYBR Green in order to obtain an optimal yield ...
-
bioRxiv - Molecular Biology 2019Quote: ... Each of the libraries was labeled by a specific barcode provided in NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 and 2) (NEB) and amplified 9-13 cycles (depending on initial material amount ...
-
bioRxiv - Neuroscience 2020Quote: The constant oligomer and the gene specific oligomer were annealed on a PCR machine and filled in using T4 DNA polymerase (NEB) (Gagnon et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was mixed with gene-specific primers and subjected to RT-qPCR using Hot Start Taq-based Luna qPCR master mix (NEB). The reaction was run on a Bio-Rad CFX Real Time PCR system ...
-
bioRxiv - Genomics 2021Quote: ... The anchor sequence was added to the 5’ end of the transcript by PCR amplification using the gene-specific reverse primer PK13 and the oligo(dT)-anchor primer and Phusion High-Fidelity DNA Polymerase (New England Biolabs). PCR products were analysed on agarose gels and purified using the QIAquick PCR purification Kit according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... the corresponding set of specific primers (Table S1) and digestion of the template from the reaction mix with DpnI (New England Biolabs), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: Cloning of the plf gene clusters and plfG and papG genes encoding the different classes of adhesins were obtained by PCR amplification using specific primers (Table 2) and Q5 High Fidelity-DNA polymerase (New England Biolabs [NEB]). The A-Tailing Kit (NEB ...
-
bioRxiv - Developmental Biology 2020Quote: ... and specific primers containing BstbI and XhoI restriction enzyme sites were used with Q5 high-fidelity DNA polymerase (New England Biolabs). The resulting amplicons were cut using BstbI and XhoI ...
-
bioRxiv - Molecular Biology 2020Quote: ... the DNA editing efficiency of the sgRNAs at their specific targeting regions was determined in K562-Cas9-sgRNA cells by the T7 endonuclease I (NEB) assay (as described in the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... beads were resuspended in 25 μl 0.5x TT and on bead PCR for addition of Illumina-specific adapters and 10-bp Unique Dual Indexes (UDIs) using NEBNext 2X High Fidelity PCR MM (NEB) and 25 PCR cycles was performed (Figure 5-table supplement 2) ...
-
bioRxiv - Cell Biology 2022Quote: ... Plasmid hcm1 sequence was amplified by PCR for 21 cycles with vector specific primers using Phusion High-Fidelity DNA polymerase (New England Biolabs). Products were extracted from a 1% agarose gel using the QIAquick Gel Extraction Kit (Qiagen) ...