Labshake search
Citations for New England Biolabs :
701 - 750 of 10000+ citations for Human Gap Junction Alpha 8 Protein CX50 GJA8 ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... The purified recombinant protein or commercial M.EcoGII (NEB, M0603S) was diluted with coating buffer (0.05 M NaHCO3 buffer ...
-
bioRxiv - Microbiology 2021Quote: ... 9 Neuraminidase A (P0722, NEB, 4 units/µg protein). 10 µg glycoprotein ...
-
bioRxiv - Microbiology 2020Quote: ... anti-maltose binding protein (MPB) (New England BioLabs #E8032L) and anti-outer membrane protein (OmpA ...
-
bioRxiv - Cell Biology 2020Quote: ... against a Color Protein Standard broad range ladder (NEB) in NuPAGE MES SDS buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 μL of Lambda Protein Phosphatase (New England Biolabs) or 1 μL of phosphatase inhibitor mix (20 mM β-glycerophosphate ...
-
bioRxiv - Developmental Biology 2021Quote: ... A pre-assembled complex of purified Cas9 protein (NEB) and gRNA was injected and the efficiency of Crispr/Cas9-induced mutagenesis in the F0 generation monitored at 24 hpf using a T7 endonuclease assay (Jao et al. ...
-
bioRxiv - Microbiology 2020Quote: ... RNA-protein complexes were dephosphorylated with T4 PNK (NEB) for 45 minutes in an Eppendorf Thermomixer at 37°C ...
-
bioRxiv - Plant Biology 2020Quote: ... 10 μM of purified proteins mixed with PEG8000 (NEB) at 10% (w/v ...
-
bioRxiv - Plant Biology 2021Quote: ... MBP-MYB6 protein was purified on amylose resin (NEB) and HIS-PUB26 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Protein expression plasmids were cloned using Gibson Assembly (NEB Gibson Assembly Master Mix ...
-
bioRxiv - Synthetic Biology 2020Quote: The protein samples of purified ribosome (New England BioLabs), E ...
-
bioRxiv - Genetics 2020Quote: ... 90 nM of SpCas9 protein (#M0386, New England Biolabs), NEB buffer 3.1 ...
-
bioRxiv - Neuroscience 2020Quote: ... H1 was transfected with pre-assembled Cas9 protein (NEB) + crRNA and tracrRNA (Synthego) ...
-
bioRxiv - Immunology 2021Quote: ... 90 nM of EnGen® Sau Cas9 protein (NEB), NEB buffer 3.1 (NEB ...
-
bioRxiv - Genetics 2020Quote: ... MEFs were protein transfected with recombinant RNase H (NEB) using Project Reagent Transfection Kit (Thermo ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The supernatants were used with lambda protein phosphatase (NEB) treatment according to its protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... using a commercially available Cas9 protein (New England Biolabs). The efficiency of creating deletion after co-injection of the sgRNA pair was determined by PCR on genomic DNA extracted from injected embryos using the following primers:
-
bioRxiv - Immunology 2023Quote: ... color prestained protein standard (New England Biolabs GmbH, Germany) was included on each gel ...
-
bioRxiv - Bioengineering 2023Quote: ... Tagless protein was expressed in Lemo21(DE3) cells (NEB) in LB (10 g Tryptone ...
-
McIdas localizes at centrioles and controls centriole numbers through PLK4-dependent phosphorylationbioRxiv - Molecular Biology 2022Quote: ... according to the manufacturer’s instructions (Lambda protein phosphatase, Biolabs). Western blot analysis was followed with an antibody against GFP (1:1000 ...
-
McIdas localizes at centrioles and controls centriole numbers through PLK4-dependent phosphorylationbioRxiv - Molecular Biology 2022Quote: ... according to the manufacturer’s instructions (Lambda protein phosphatase, Biolabs). In parallel ...
-
bioRxiv - Cell Biology 2024Quote: ... RRID:Addgene_119754).CAPS-GST protein was expressed in BL21Star bacteria (NEB); the protein was isolated by binding to glutathione-Sepharose (Pierce ...
-
bioRxiv - Neuroscience 2024Quote: ... 25-50 ul Protein G Magnetic Beads (NEB #S1430S) were incubated with 3ug GFP (D5.1 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Synthesized sgRNA was mixed with Cas9 protein (NEB# M0646T) just before microinjection into zebrafish embryo.
-
bioRxiv - Biophysics 2023Quote: ... Proteins were cleaved with TEV protease (New England Biolabs) and further purified via reverse IMAC ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were subsequently purified on amylose resin (E8021L, NEB): 3 ml resin per column and 45 ml of extract ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein A beads (10 µl, New England Biolabs, #S1425) were washed twice in coIP-solution and consecutively incubated for 1 hour at 4°C with an anti-synaptopodin antibody (rabbit anti-Synaptopodin ...
-
bioRxiv - Molecular Biology 2022Quote: ... The eluted protein was applied to Amylose resin (NEB) equilibrated with buffer D (20 mM Tris-HCl ...
-
bioRxiv - Microbiology 2022Quote: ... 30 μg of Protein G magnetic beads (NEB #S1430) was washed with 250 μl of Immunoprecipitation Reaction Buffer (150 mM NaCl ...
-
bioRxiv - Biochemistry 2023Quote: ... The protein was first purified on amylose resin (NEB) in a buffer containing 20 mM Tris pH 8 ...
-
bioRxiv - Cell Biology 2023Quote: ... Biotinylated proteins were separated on magnetic streptavidin resin (NEB) and eluted with 2× SDS loading buffer supplemented with 4% SDS and 10 mM Β-mercaptoethanol ...
-
bioRxiv - Physiology 2024Quote: ... Nuclear proteins were extracted using nuclear extraction buffer (NEB) (20mM HEPES pH7.9 ...
-
bioRxiv - Biophysics 2024Quote: ... The sample was phosphorylated using protein kinase A (NEB) and then further purified on size exclusion chromatography.
-
bioRxiv - Molecular Biology 2024Quote: ... 300 pmol of Cas9 protein (NEB, Cat. No. M0386M) and 600 pmol of sgRNA were incubated in Cas9 Buffer (150 mM KCl ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Protein expression plasmids were cloned using Gibson Assembly (NEB Gibson Assembly Master Mix ...
-
bioRxiv - Neuroscience 2024Quote: ... Protein deglycosylation mix II (New England Biolabs, Cat# P6044S) was added to the treated tubes and buffer only was added to the control tubes ...
-
bioRxiv - Genetics 2020Quote: ... ~15nM (3ug) human genomic DNA or 30ng of gBlock in 1x Cutsmart buffer (NEB B7204) was incubated at 37°C for 15 minutes.
-
bioRxiv - Cell Biology 2023Quote: Human ARHGAP18 constructs were created using Polymerase Chain Reaction (PCR) using New England Biolabs (NEB) Phusion High-Fidelity PCR Kit (catalog no ...
-
bioRxiv - Cell Biology 2024Quote: Human ARHGAP18 constructs were produced using polymerase chain reaction (PCR) with New England Biolabs (NEB) Phusion High-Fidelity PCR Kit (Cat# E0553L) ...
-
bioRxiv - Cell Biology 2022Quote: ... and protein samples and molecular weight markers (PageRuler Plus Pre-stained Protein Ladder, ThermoFisher Scientific 26619, or Colour pre-stained protein standards NEB P7712 or P7719) were separated using 8% ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 % SDS-PAGE gel was prepared and 50 μg of protein lysate was loaded along with the protein standard ladder (Cat.No.: P7719S, New England Biolabs, Ipswich, Massachusetts, United States), and electrophoresis was performed for 1.5 hr in ice-cold 1x Laemmli electrophoresis running buffer ...
-
bioRxiv - Immunology 2024Quote: ... Strand extension was performed at 37°C for 10 minutes using 5uM of ssDNA binding protein (T4 Gene 32 Protein, NEB, Cat No. M0300S) and 0.8U/µL of Klenow Fragment (3’-5’ exo- ...
-
bioRxiv - Genetics 2021Quote: ... including 8 bp barcode and P5 overhang (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCATCTTTGTGGAAAGGACGAAA CACCG-3’) using the Q5 Hot Start High-Fidelity polymerase (NEB #M0494S) for 22-24 cycles ...
-
bioRxiv - Evolutionary Biology 2021Quote: Reverse transcription was performed by adding the following to the above reaction: 8 uL of 5x first strand buffer (NEB E7330L), 2 uL of 10mM dNTPs (each) ...
-
bioRxiv - Molecular Biology 2021Quote: ... was resuspended in 10x NEB CutSmart Buffer (8:1) and dephosphorylated by incubation with Quick calf intestinal phosphatase (CIP) (NEB, # M0525S) at 37 °C for 20 min ...
-
bioRxiv - Biochemistry 2020Quote: ... and 8 pmol of purified DNA was then used for in vitro transcription with T7 RNA polymerase (New England Biolabs Inc.). The resulting RNA was purified with Agencourt RNAClean XP beads supplemented with an additional 12% of PEG-8000 (3 volumes of 40% PEG-8000 was added to 7 volumes Agencourt RNAClean XP beads ...
-
bioRxiv - Biochemistry 2021Quote: ... libraries were generated using 5 μl of the purified RT reaction product and 4-8 cycles of PCR with Q5 high fidelity polymerase (NEB, M0491S). PCR reaction products were column purified ...
-
bioRxiv - Microbiology 2020Quote: ... After adding 10% 1M sodium dodecyl sulphate (SDS) and 10 μL of 8 U/mL proteinase K (NEB, #P8107S, Ipswich, MA), the suspension was then incubated at 56°C for 4 hours ...
-
bioRxiv - Cancer Biology 2022Quote: ... for 5 min and then samples were incubated with ligation buffer (8 μl of 5x ligation stock (New England Biolabs, USA), 1 μl ligase and 31 μl of ultrapure water on each coverslip ...
-
bioRxiv - Microbiology 2020Quote: ... The flies were homogenised in 100 μl of TE-buffer pH 8 containing 1% Triton X-100 and 1% Proteinase K (NEB, P8107S). Homogenates were incubated for 3 h at 55°C followed by a 10 min incubation step at 95°C ...