Labshake search
Citations for New England Biolabs :
701 - 750 of 6985 citations for 7 Amino 8 oxo 3 cis prop 1 enyl 5 thia 1 azabicyclo 4.2.0 oct 2 ene 2 carboxylic acid diphenylmethyl ester hydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... Two concentrations of 2-log ladders (NEB) were included as reference for analysis ...
-
bioRxiv - Immunology 2021Quote: ... Step 2 was digested with EcoRI (NEB), blunted with Klenow (NEB ...
-
bioRxiv - Genetics 2019Quote: ... 2 μL of β-agarase (NEB M0392S) and 2 μL of RNAse A (Roche 1 119 915 ...
-
bioRxiv - Genomics 2022Quote: ... 10 μl of 2% BSA (NEB B9000S), 2 μl of 20 U/mL SUPERaseIn ...
-
bioRxiv - Synthetic Biology 2023Quote: ... rabbit anti-Sox-2 (New England Biolabs), and rabbit anti-NANOG (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 mM ribonucleoside vanadyl complex (NEB, S1402S), 100 units/mL SUPERaseIn (Thermo Fisher ...
-
bioRxiv - Microbiology 2023Quote: ... 2 mM vanadyl ribonucleoside complex (NEB, S1402S). The cells were then washed 4 times in wash buffer containing 25% formamide (Roche ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 2 μM NLS-Cas9 (New England Biolabs) and 1x NLS-Cas9 reaction Buffer (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μl 10x T4 ligase buffer (NEB), 0.2 μl 0.1 M ATP (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL 10 µM RP1 primer (NEB), 1 µL ddH2O and PCR amplified for 16-18 cycles ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µL 10 µM RPI primer (NEB), 2 µL 10 µM RP1 primer (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μl 10×T4 ligase buffer (NEB), 0.2 μl 0.1 M ATP (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μl T7 RNA Polymerase Mix (NEB) in a total of 20 μl ...
-
bioRxiv - Biochemistry 2023Quote: ... and 2 U alkaline phosphatase (QuickCIP, NEB) in MgCl2 (1 mM ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 μL of rCutSmart Buffer (NEB, B6004S), 1 μL of PaqCI/AarI activator (5 pmol ...
-
bioRxiv - Genetics 2023Quote: ... 2 µl of T4 DNA ligase (NEB), and 9 µl nuclease-free water were mixed and incubated at 22°C for 2 hours ...
-
bioRxiv - Genomics 2023Quote: ... 2 µl of T4 DNA ligase (NEB), and 9 µl nuclease-free water were mixed and incubated at 22°C for 2 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2 mM VRC (New England Biolabs).
-
bioRxiv - Cell Biology 2023Quote: Recombinant human Casein Kinase 2 (NEB, P6010S) and Protein Kinase A (NEB ...
-
bioRxiv - Biophysics 2023Quote: ... in NEBuffer 2 (New England Biolabs #B6002) at 37°C for 30 minutes followed by column purification ...
-
bioRxiv - Genomics 2023Quote: ... and 2 mM VRC (New England Biolabs) for 7 min on ice and stored in 70% ethanol ...
-
bioRxiv - Genomics 2023Quote: ... 2 μL 10×ThermoPol Reaction Buffer (NEB), 0.5 μL 10 mM dNTP mix ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 μl T4 PNK (NEB, #M0201L) to the dephosphorylated nuclei sample and incubate at 37°C for 15 min ...
-
bioRxiv - Cell Biology 2024Quote: ... + 2 mM vanadyl-ribonucleoside complex (NEB S1402) + 0.02% [w/v] BSA ...
-
bioRxiv - Genetics 2024Quote: ... 2 mM Vanadyl Ribonucleoside complex (NEB S142), 0.5% BSA (Ambion ...
-
bioRxiv - Genomics 2024Quote: ... 2 μl of Antarctic Phosphatase Enzyme (NEB), and 2 μl of water ...
-
bioRxiv - Molecular Biology 2020Quote: ... Briefly 60 ng ±10% of total RNA was subjected to small RNA library preparation by using the NEBNext Multiplex Small RNA Library Prep Set 1 and 2 for Illumina (NEB, Ipswich, MA, USA) kit according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10 µ l of cfDNA was incubated at 37°C for 1 hour with the following reaction mixture: NEBuffer™ 2 (NEB, B7202), 0.25 mM MnCl2 (SIGMA ...
-
bioRxiv - Biochemistry 2021Quote: ... 500 ng total of the purified PCR products were mixed with 1 μl 10× NEBuffer 2 (New England Biolabs Inc., Beverly, MA, USA) and ultrapure water to a final volume of 9.75 μl ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... All DNA fragments were indexed using NEBNext Multiplex Oligos for Illumina (Dual Index Primer sets 1 and 2, New England Biolabs, Ipswich, MA, USA).
-
bioRxiv - Biochemistry 2023Quote: ... In vitro RNA methylation experiments were performed for 2 h at 37 °C in 20 μL reaction mixtures containing 1× CutSmart buffer (New England Biolabs Inc., Massachusetts, USA) with 1 μg RNA and 1 unit RNase Inhibitor (New England Biolabs Inc. ...
-
bioRxiv - Developmental Biology 2019Quote: ... The bound protein (~42kDa, 360 amino acids) was released from the MBP tag by cleavage with Factor Xa (New England Biolabs, Massachusetts, United States) for 24 hours at 4°C in 20mMTris pH 7.2 ...
-
bioRxiv - Biochemistry 2019Quote: ... a 5’ RNA adapter (GCAATTAACCCTCACTAAAGGAGTCGT) lacking 5’ phosphate was ligated with T4 RNA Ligase 1 (NEB #M0204S). Ligation products were gel-purified ...
-
bioRxiv - Microbiology 2023Quote: ... the gRNA cassette carrying the human U6 promoter and the invariant scaffold sgRNA sequence was inserted into the HIV-1 NL4-3 and HIV-1 CH077 pro-viral DNA between separated Nef and 3’LTR region using homologous recombination (NEB builder Hifi DNA assembly mastermix ...
-
bioRxiv - Neuroscience 2019Quote: ... 1 µM NGFR121W-SNAP was coupled with 3 µM BG549 surface (NEB # S9112) for 1 hour at 37°C in calcium imaging (CIB ...
-
bioRxiv - Genomics 2022Quote: ... We ligated a 3’ adapter ligation using T4 RNA Ligase 1 (NEB, M0204L). We performed a second bead binding followed by a 5’ decapping with RppH (NEB ...
-
bioRxiv - Evolutionary Biology 2021Quote: 5’ adapter ligation was performed by adding 3 uL of 10uM 5’ adaptor (which was previously denatured by heating to 70 C for 2 minutes and placed on ice, NEB E7330L), 2 uL of 10X T4 RNA ligation buffer (NEB B0216L) ...
-
bioRxiv - Biochemistry 2020Quote: ... Cross-links were reversed from eluted chromatin by adding 6 μL of 5 M NaCl and 2 μL Proteinase K (NEB; P8107S) and incubation overnight at 65°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads were next resuspended in 1X Thermo Pol Buffer and treated with 2 µL RNA 5’ Pyrophosphohydrolase (New England Biolabs M0356) at 37°C for 1 h to promote decapping of 5’ RNA ends ...
-
bioRxiv - Genetics 2022Quote: ... and 2 μg of DNA was digested with 50 units of NlaIII and 5 μL CutSmart® Buffer (NEB, cat #R0125L), in a total volume of 50 μL ...
-
bioRxiv - Biochemistry 2023Quote: ... and ligated to pre-adenylated linkers (NI-810 to NI-815) containing 5 nt sample barcodes unique for each sample using truncated T4 RNA ligase 2 (K227Q) (NEB; M0351L). Ligated fragments were separated from free linkers on a 15% polyacrylamide TBE-Urea gel and then pooled and purified for reverse transcription using RT primer NI-802 and ProtoScript II Reverse Transcriptase (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... The resulting eluant was further treated with 1% SDS and 8 U/mL proteinase K (NEB, P8107S) at 42°C for 20 minutes then phenol chloroform extracted and ethanol precipitated.
-
bioRxiv - Biochemistry 2021Quote: ... sDrl-2 for crystallization was also partially deglycosylated with PNGase F (New England BioLabs: 2,000 unit/mg sDrl-2) for 3 h at room temperature before sizing.
-
bioRxiv - Systems Biology 2019Quote: ... the samples were added to 2 μL of second-strand synthesis mix (2.5× NEB buffer 2 [New England Biolabs] ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 μl of this lysate was directly used for PCR reactions with 2× Taq start master mix (M0496L, NEB), and the two NASP clone screening primers (see primer table) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... These were phosphorylated (2 μL 100 μM oligo stock, 2 μL 10X T4 DNA ligase buffer (New England Biolabs), 1 μL T4 PNK (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 200 nM dT adaptor primer and 200 nM Vλ1-GSP4-2-Hind III and 2 U Taq polymerase (NEB), in a final volume of 50 µl ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 1 µl murine RNase inhibitor per sample and 3 µl were added to each sample together with 2 µl truncated T4 polynucleotide kinase (#M0201, NEB; Frankfurt/Main, Germany). Samples were incubated for 2 h at 37°C and the enzyme was deactivated after the reaction by 10 min incubation at 75°C ...
-
bioRxiv - Biochemistry 2023Quote: The library was ligated to the barcode oligonucleotide at a 7:1 oligo:library ratio overnight at 16 °C with T4 DNA ligase (New England Biolabs). A no-insert negative control was also ligated overnight using identical conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... a ratio of 7:1 (oligo:library) was used overnight at 16 °C with T4 DNA ligase (New England Biolabs). The products were purified and eluted in 6 μL water (Zymo Clean and Concentrate) ...