Labshake search
Citations for New England Biolabs :
701 - 750 of 1774 citations for 6 Quinoxalinamine N 3 8 trimethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... and both inserted between the XhoI and EcoRI sites of the parental pLVX N-term GFP vector using Gibson Assembly (New England Biolabs), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... was fused to an HA-tag at its N-terminus during PCR and cloned into the lentiviral vector pLJM1 linearized with AgeI (NEB) and EcoRI (NEB ...
-
bioRxiv - Biophysics 2019Quote: ... was generated as a fusion construct with N-terminal maltose binding protein (MBP) as we described previously (45) using the pMAL-c2x (New England Biolabs) variant pMALX (46) ...
-
bioRxiv - Cell Biology 2019Quote: ... were expressed as fusion proteins with an N-terminal maltose binding protein (MBP)-tag using the pMALTMc5x-vector (New England Biolabs). Cloning was mediated by the addition of the restriction sites XmnI/PstI to the ends of gene fragments PCR-amplified from P ...
-
bioRxiv - Genomics 2021Quote: The AID N-terminal AID-RPB1 vector was assembled by Gibson Assembly (NEBuilder HiFi DNA Assembly Master Mix, NEB, E2621L) in the pENTR221 kanamycin vector using the following templates ...
-
bioRxiv - Biochemistry 2021Quote: The α-(1,2)-Galf-containing N-linked glycans were released from 1 mg Transglucosidase L “Amano” (Amano) by using PNGase F (New England Biolabs) under denaturing conditions ...
-
bioRxiv - Biochemistry 2021Quote: ... using a plasmid that codes for the desired protein sequence fused to an N-terminal intein and chitin binding domain (CBD) as part of the IMPACT purification system (NEB). 2 liters of cells were grown to an OD600 of 0.6 and induced with 1 mM IPTG for 3 hours at 25 °C ...
-
bioRxiv - Microbiology 2021Quote: ... The fragment of sNTurboID was PCR amplified from pLX304 CMV FKBP-V5-sTurboID (N) and cloned into the pcDNA5-VP35-HA using NEBuilder HiFi DNA Assembly Master Mix (NEB). The fragment of VP35-sNTurboID ...
-
bioRxiv - Cancer Biology 2020Quote: ... were added to each quadrant of the 96-well plate (n = 24 unique adapters) with a ligation mixture of 40 Weiss U T4 ligase (NEB), 1mM ATP (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were heated for 1 minute at 100°C followed by the addition of 2 μL of peptide N-glycosidase F (New England Biolabs) to release the N-glycans ...
-
bioRxiv - Microbiology 2021Quote: ... Point mutations were introduced in the P and N sequences by site-directed mutagenesis using the Q5 site-directed mutagenesis Kit (New England Biolabs). Sequence analysis was carried out to check the integrity of all constructs ...
-
bioRxiv - Genetics 2020Quote: ... An 18-mer poly-N barcode was created by annealing primers (Table S1) and extended to make fully double stranded with Klenow polymerase (NEB). The barcode was then PCR purified (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... containing an N-terminal 6xHis tag and TEV site was produced in Escherichia coli NiCo21 (DE3) cells (New England Biolabs) as previously described in https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6069193/ ...
-
bioRxiv - Microbiology 2022Quote: ... Mutations to the specificity of guides in pTREX-n-Cas9 were performed using a Q5 mutagenesis kit (NEB, Ipswich, Massachusetts). Guides targeting the ELO genes were inserted using the primers described in Table 1 ...
-
bioRxiv - Microbiology 2022Quote: ... and Atd1 and containing an N-terminal TEV cleavage site were cloned directly via Gibson assembly (NEBuilder HiFi, New England Biolabs) into BamHI/NotI-digested pGEX4-1 (GE Healthcare) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... was inserted into a gel-purified N-terminal sub-cloning vector digested with MluI and KpnI restriction enzymes (New England Biolabs). Cas13 C-terminal fragments were also PCR amplified out of the full Cas13 sequence templates mentioned above to contain a 5′ sequence to code for the KpnI restriction site a start codon ...
-
bioRxiv - Microbiology 2023Quote: ... Point mutations were introduced in the N sequence by site-directed mutagenesis using the Q5 site-directed mutagenesis Kit (New England Biolabs). Sequence analysis was carried out to check the integrity of all constructs ...
-
bioRxiv - Bioengineering 2023Quote: ... TADs were directly fused to the N-terminus to dCas9 by digesting the FLAG-NLS-MCS-linker-dCas9 plasmid with AgeI (NEB) and then cloning in PCR-amplified TADs using NEBuilder HiFi DNA Assembly ...
-
bioRxiv - Cell Biology 2023Quote: ... was fused in frame to the N-terminus of LRRK2 between the PreScission recognition sequence and NotI restriction site using HiFi assembly (NEB). A plasmid encoding Rab8 was previously generated in the De Camilli lab.
-
bioRxiv - Cell Biology 2022Quote: ... All hybrid constructs were tested for expression and cloned into the pcDNA5/FRT/TO-N-FLAG-hBirA* using restriction enzymes: 5’ KpnI (NEB) and 3’ NotI (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... double and triple N>G mutations were introduced in the parental constructs by using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) according to the manufacturers protocols and using custom designed primer ...
-
bioRxiv - Cancer Biology 2023Quote: ... Shipston and was N-terminally attached to an RFP (BKCa-DECRFP) using KpnI and BamHI restriction sites after PCR amplification (NEB Q5 High-Fidelity DNA-Polymerase ...
-
bioRxiv - Biochemistry 2023Quote: ... Cleared lysate containing the nucleosomes was incubated with purified MBP-tag or MBP-FoxP3ΔN protein (1uM) for 1 hour at 4℃ and then subjected to MBP pulldown using Amylose Resin (New England Biolabs). After proteinase K (New England Biolabs ...
-
bioRxiv - Plant Biology 2024Quote: ... in an N-terminal fusion (MIROs are tail anchored proteins) with mCherry that was generated by Gibson assembly (New England Biolabs, Ipswich ...
-
bioRxiv - Molecular Biology 2024Quote: ... Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT) within loxP-N with the lox17:2272 site (ATAACTTCGTATAGGATACTTTATAGCAATTTAT) using a Q5 Site-Directed Mutagenesis kit (New England Biolabs) and PCR ...
-
bioRxiv - Immunology 2024Quote: N-linked glycans were enzymatically released from purified mouse THP using PNGase-F kit (catalog no P0709S, New England Biolabs). N-glycans were then purified from the reaction mixture containing denaturing buffer and de-N-glycosylated proteins by solid phase extraction method using Sep-Pak C18 (1 cc Vac-cartridges ...
-
bioRxiv - Cell Biology 2024Quote: ... Library preparation was slightly different and performed using the NEBNext® rRNA Depletion kit and protocol (NEB; P/N: E7850X) per manufacturer recommendations ...
-
bioRxiv - Biochemistry 2023Quote: ... The pCR8[mZC3H18] plasmid was used as a template to generate subsequent ZC3H18 cDNA constructs that were cloned into a piggyBAC (pB) vector containing an N-terminal MYC tag and BSD selection marker using NEBbuilder HiFI DNA assembly (NEB). OsTIR1-HA ...
-
bioRxiv - Cell Biology 2020Quote: Purified GST-Bbs5 protein (400 μg) was incubated with 6 μl of PKC (New England Biolabs) and 10 μl of ATP (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: Two-hundred nanograms of total RNAs were reverse-transcribed using Random primer 6 (New England Biolabs) and Superscript III reverse transcriptase ...
-
bioRxiv - Neuroscience 2021Quote: ... we introduced a 6-bp mutation using the Q5 site-directed mutagenesis kit (New England Biolabs). The pUAST-attB constructs were inserted into either attP40 or attP86Fb (for Piezo constructs ...
-
bioRxiv - Microbiology 2020Quote: ... and performed 6–9 cycles of PCR with the NEBNext Ultra II Q5 Master Mix (NEB) using Illumina P7 and the Seq-Well P5-TSO hybrid primer (Gierahn et al. ...
-
bioRxiv - Systems Biology 2021Quote: ... Polylinker libraries were amplified using primers BC_CRX_Nested_F and BC_CRX_R (Supplementary file 6) for 30 cycles (NEB Q5) at an annealing temperature of 67C and then purified with the Monarch PCR kit ...
-
bioRxiv - Plant Biology 2021Quote: ... 5 and 6 and then assembled into pASW vector by NEBuilder Hifi DNA Assembly kit (NEB).
-
bioRxiv - Systems Biology 2019Quote: ... Biotinylation was performed in a 90 µl reaction with 6 U of T4 ssRNA Ligase (NEB), 4 µl Biotinylated Cytidine (Thermo Fisher ...
-
bioRxiv - Microbiology 2022Quote: ... The extracted dsRNA was mixed with Gel Loading Dye Purple (6×) (New England Biolabs, cat. #B7024S) and separated by 10% polyacrylamide gel (25 mA at 4°C for 18 hours) ...
-
bioRxiv - Biochemistry 2022Quote: ... the refolded 6×His-tagged precursors were treated with enterokinase (New England Biolabs, Ipswich, MA, USA) to remove their N-terminal 6×His-tag according to our previous procedure [3,18] and purified by HPLC using an analytical C18 reverse-phase column (Zorbax 300SB-C18 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 6 µl aliquots were 5’ adapter ligated (25 µl of 1× T4 RNA ligase buffer (NEB), 1 mM ATP ...
-
bioRxiv - Genomics 2024Quote: ... the cfDNA can be de-phosphorylated by adding 6 μl of Antarctic Phosphatase buffer 10x (NEB), 2 μl of Antarctic Phosphatase Enzyme (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... together with the Bakt_314F (CCTACGGGNGGCWGCAG) and Bakt_805R (GACTACGVGGGTATCTAATCC)38 PCR primer pair with an individual 8 bp barcode adapter (based on the NEB Multiplex Oligos for Illumina ...
-
bioRxiv - Bioengineering 2020Quote: ... Constriction was performed by diluting a library to approximately 8 fM (~5,000 molecules/μl) in salmon sperm DNA (1 ng/μl, New England Biolabs) in low-binding tubes (LoBind ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 1:8 dilution Cas9 protein (New England Biolabs, cat. M0386M; diluted in buffer B, New England Biolabs, cat. B802S) and 1:40 dilution of phenol red (Sigma Aldrich) ...
-
bioRxiv - Evolutionary Biology 2021Quote: DNA was isolated from single fins by placing them in lysis buffer (10mM Tris pH 8, 100mM NaCl, 10 mM EDTA, 0.5% SDS) with Proteinase K (333µg/mL, NEB P8107S) at 55°C for between four hours and overnight ...
-
bioRxiv - Molecular Biology 2021Quote: ... Two separate 8-µl aliquots of beads derived from each strain were treated with 1 µl lambda phosphatase (NEB) in 10 µl reactions containing ...
-
bioRxiv - Microbiology 2020Quote: ... Beads were resuspended in 48 μL elution buffer (50 mM Tris pH 8, 1 mM EDTA, 1% SDS) and 1.6 U Proteinase K (NEB), incubated at 55 °C for one hour and then 65 °C overnight ...
-
bioRxiv - Systems Biology 2020Quote: ... A total of 8 cDNA libraries were prepared with an NEBNext Ultra II RNA Library Prep kit (NEB, cat:E7770S) and sequenced with an Illumina HiSeq4000 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Barcodes (4-8 bp) and common adapters were ligated with 400 U T4 DNA ligase (New England Biolabs Inc.) at 22 C for 1 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... 8 μl of a mix preheated to 37°C and containing 2.5 U of RNase H (New England Biolabs), 2.5× RNase H reaction buffer (1× buffer ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were amplified by PCR for a total of 8 cycles in 100µL reactions with Phusion polymerase (New England Biolabs). No PAGE purification was performed to ensure that our libraries were not biased against short nascent RNA insertions.
-
bioRxiv - Microbiology 2023Quote: ... by mixing 2 ul 1:10.000 diluted library with 8 ul Quant mastermix with added primers (New England Biolabs). Due to low initial concentration of adapter ligated product we made triplicates of the library ...