Labshake search
Citations for New England Biolabs :
701 - 750 of 6813 citations for 2 Chloro 1 1 trifluoromethyl 1 3 4 9 tetrahydro 2H beta carbolin 2 yl ethan 1 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... and PCR amplified for 7-9 cycles depending on the samples using NEBNext High Fidelity 2× PCR master mix (New England Biolabs). The optimal cycle number was determined empirically each time by qPCR ...
-
bioRxiv - Genomics 2021Quote: ... the purified products are treated with Klenow fragment (3’ → 5’ exo-) (Cat. No. M0212L; NEB; use 1 uL) and Taq DNA polymerase (Cat ...
-
bioRxiv - Molecular Biology 2021Quote: ... Promoters (Supplemental Figure 1, Supplemental Table 3) were amplified from genomic DNA using Q5 polymerase (New England Biolabs) and inserted between the enhancer and 24xMS2 sequences using restriction enzyme-mediated ligation ...
-
bioRxiv - Molecular Biology 2023Quote: CDKN1A intron 1 APA 3’ splice site was deleted using Q5 Site-Directed Mutagenesis Kit (New England Biolabs) as per the manufacturer’s instructions using forward primer (5’-TCCCCACCCCAAAATGACGCGCAGCC-3’ ...
-
bioRxiv - Cancer Biology 2023Quote: ... Ligation of the RNA 3’ Adapter (RA3) was achieved by using T4 RNA Ligase 1 (NEB, Ipswich, MA) according to manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The ligations were transformed into high efficiency (1-3 × 109 CFU/μg pUC19 DNA) competent cells (NEB C3040). The transformations were serially diluted and plated on LB with ampicillin (100 μg/ml) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Library preparation for sRNA from sperm samples was done using the New England BioLabs kit NEBNext® Multiplex Small RNA Library Prep Set for Illumina® Set 1 and 2 (NEB #E7300 and NEB #E7580). The provided guidelines of NEB were followed for small sample preparation until step 15 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μl GlycoBuffer 2 (10X) (NEB, B3704S), 2 μl 10% NP-40 (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... annealed and phosphorylated sgRNA (1:10) and T4 Ligase reaction buffer (1:10, #B0202S, New England Biolabs) with 10 mM 10x Adenosine 5’-Triphosphate (#P0756S ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proximity ligation was done under the following conditions: 1 unit/µl RNA ligase 1 (New England Biolabs), 1x RNA ligase buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 mM EDTA pH 8.0 (Roth) and 1:100 Proteinase K (New England Biolabs 20 mg/ml)) in a 2 ml Eppendorf tube for at least 24 hours at RT in the dark ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 µl of 1 mM BG-(PEG)12-biotin (New England Biolabs; PEG linker available on request) was added to 200 µl of axonemes ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 µg of each pFRT-TO-CLIP-UPF1 mutant vector was digested with 1 µL SpeI (NEB) and 1 µL HindIII-HF (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... A 1 ml aliquot of each phage was treated with 1 µl DNase (New England Biolabs, USA) at 37 ⁰C for 40 minutes ...
-
bioRxiv - Genomics 2022Quote: ... and the PCR products were analyzed in 1% agarose with 1 kb DNA Ladder (New England Biolabs). Primers used in this study are shown in Supplemental Table S1.
-
bioRxiv - Genomics 2024Quote: ... cells were incubated for 1 hr at RT with 1 µl of Nt.CviPII-pGL (NEB, 0.5 units) in 800 µl binding buffer per well (20 mM potassium phosphate pH 7.0 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and assembled into RNP complexes following the manufacturer’s instructions with a Cas9:gRNA or Cas12a:crRNA ratio of 1:1 in NEBuffer 3.1 (NEB). 8µg of Cas9 or Cas12a complexed with equimolar ratios of gRNA/crRNA were transfected into Ulva unless stated otherwise.
-
bioRxiv - Synthetic Biology 2024Quote: ... qPCR reactions were performed on 1 µL cDNA (diluted 1:8 in water) with Q5 polymerase (NEB), SYBR Green (Thermo Fisher) ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Cell Biology 2020Quote: ... The extract was incubated for 1 h at 4 °C with amylose resin (New England Biolabs, Ipswich, MA), loaded onto a column ...
-
bioRxiv - Biochemistry 2022Quote: ... The unbound fraction was then incubated for 1 hour at 4 °C with lambda phosphatase (New England Biolabs), calf intestinal phosphatase (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 million permeabilized cells (without any antibodies bound) were incubated with 4 units of Dam enzyme (NEB, M0222L) during the activation step ...
-
bioRxiv - Biochemistry 2021Quote: ... The resulting Gβ1γ2 was then incubated for 1 hour at 4 °C with lambda phosphatase (New England Biolabs), calf intestinal phosphatase (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... A mixture containing 1 μl of a 4-fold dilution of Low Range ssRNA Ladder (New England Biolabs) and 0.75 pmol each of RPIX_SC1_Bridge ...
-
bioRxiv - Biochemistry 2024Quote: ... The unbound fraction was then incubated for 1 h at 4 °C with lambda phosphatase (New England Biolabs), calf intestinal phosphatase (New England Biolabs) ...
-
bioRxiv - Genomics 2024Quote: ... NEBNext Multiplex Oligos for Illumina (Index Primer Sets 1-4) (Cat# E7335L, E7500L, E7710L, E7730L, New England Biolabs) were used for indexing during library preparation ...
-
bioRxiv - Molecular Biology 2023Quote: ... Oligos for side 1 and 2 were dimerized separately by mixing 9 μl of OligoA at 100 μM with 9 μl of OligoB at 100 μM and 2 μl of 10x DNA Ligase Buffer (NEB, M0202S) and heating to 95 °C for 5 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... The fragment was ligated into the pLSV101 vector (3:1 molar ratio) with T4 DNA ligase (New England Biolabs) (16 °C overnight) ...
-
bioRxiv - Molecular Biology 2021Quote: ... before incubation during 6 min in 50μl of PNK reaction mix (1x PNKT, 1 mM ATP and 0.05 U/ml T4 PNK 3′phosphatase minus (NEB) in a thermomixer at 37°C and 1400rpm ...
-
bioRxiv - Microbiology 2021Quote: ... the THN gene was ligated to pICH41021 in a 3:1 molar ratio using T4 Ligase (New England Biolabs) at 4°C overnight and transformed by heat shock into chemically competent E ...
-
bioRxiv - Cancer Biology 2022Quote: ... Ligation of the 3’ adapter was done using the T4 RNA Ligase 1 (New England Biolabs, Ipswich, MA, M0204L). Ligation of 5’ adaptor required (i ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ terminus of total RNAs were ligated with the irCLIP adaptor by T4 RNA Ligase 1 (NEB, M0437M). After ligation ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 20 minutes at 80 °C followed by adding annealed inserts to vector DNA (0.020 pmol) at a 3:1 molar ratio with T4 DNA ligase (400 units; M0202S, New England Biolabs), T4 DNA ligase buffer and nuclease free water to a final volume of 20 μL for 30 minutes at room temperature and then 65 °C for 10 minutes.
-
bioRxiv - Systems Biology 2020Quote: 3’ ends of the RNA fragments were dephosphorylated using 0.5 U μl−1 calf intestinal phosphatase (New England Biolabs) for 10 min at 37°C ...
-
bioRxiv - Neuroscience 2024Quote: ... After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’) using T4 RNA ligase 1 (New England Biolabs; M0204S), the RT primer was annealed to the 3’-adapter ...
-
bioRxiv - Biochemistry 2024Quote: ... 0.5 μM fluorescently tagged 3’ adapter (MultiplexDX) were ligated with T4 Rnl2(1–249)K227Q (M0351, New England Biolabs) overnight at 4°C and washed three times with PNK/ligation buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... Ligation of 5’ adaptor to already 3’ ligated RNA product was performed with T4 RNA ligase 1 (NEB, #EL0021) at 37°C for 1 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... aurantiaca DW4/3–1 genomic DNA and cut by restriction enzymes NdeI and HindIII (New England Biolabs, Beverly, USA), and ligated into the corresponding sites of the expression vector pET28c(+ ...
-
bioRxiv - Developmental Biology 2023Quote: ... mixed in a ratio 1:3 (insert:backbone plasmid) and ligated with T4 ligase according to manufacturer’s instructions (Quick Ligation kit, NEB M2200). The ligation reaction was transformed into competent TOP-10 bacteria and plated on agarose plates with Ampicillin ...
-
bioRxiv - Biochemistry 2024Quote: ... The pellet was resuspended in 3 μL of 1 mM NaOAc pH 5.2 and immediately added to a PURExpress (ΔtRNA, Δaa) (New England Biolabs) reaction containing 2.5 μL solution A ...
-
bioRxiv - Genomics 2020Quote: ... 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) for A-tailing at 37°C for 30 min ...
-
bioRxiv - Plant Biology 2021Quote: ... for 3 hours at 55°C and M-2 was digested with XhoI (NEB) overnight at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adenylation reactions were conducted by adding 5 μL of NEB buffer 2 (NEB), 1 μL 10 mM dATP ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA was ligated with 3′-adenylated adapters using T4 RNA Ligase 2 (NEB #MO351) for 4 hrs at 16°C ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 μL of 2% SDS and 2 μL of proteinase K (New England Biolabs) were added and the solution was incubated at 37°C for 1 hour before purification with the Qiagen DNA clean up kit ...
-
bioRxiv - Molecular Biology 2021Quote: ... The DNA was diluted to 0.2 ng.μl-1 and 1 ng was analysed by qPCR using Luna Universal qPCR MasterMix (NEB) with 500nM of primers ...
-
bioRxiv - Cell Biology 2020Quote: ... Single-stranded DNA primers and primer dimers were digested using 1 unit μL−1 ExoI (New England Biolabs) and 1 U μL−1 HinFI (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... but instead of ATP 1 mM MnCl2 was added and 1 μl (400 U) of λ phosphatase (NEB) was used instead of PKR.
-
bioRxiv - Cell Biology 2021Quote: ... with additionally 1 μl oligo-dT primers and 1 μl of dNTP mix (NEB Biolabs, Ipswich, MA, USA). Further ...