Labshake search
Citations for New England Biolabs :
701 - 750 of 7197 citations for 2 1 ethylpentyl 1 3 dioxan 5 yl laurate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Genomic DNA was digested for 2-3 hours at 37°C with StuI or SphI restriction enzymes (NEB), as indicated in the figure legends ...
-
bioRxiv - Genomics 2023Quote: ... with the ligation of 3′-small RNA Tru-Seq adapter using the truncated T4 RNA Ligase 2 (NEB). 45-150 nt capped small RNAs were recovered on 15% Urea-TBE gel (Novex ...
-
bioRxiv - Genomics 2022Quote: ... The DNA was digested with MluCI (5µl Cut smart buffer, 1.5-2 µg DNA, 3 µl MluCI (New England Biolabs Inc. (NEB), and water to make up 49 µl ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3’ RNA adaptor (/ 5Phos/NNNNNNNNGAUCGUCGGACUGUAGAACUCUGAAC/3InvdT/) is ligated at 5 μM concentration for 1 hours at room temperature using T4 RNA ligase (NEB), followed by 2 consecutive streptavidin bead bindings and extractions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Supplementary Table 7) were ligated to 5 μg of total RNA using 10 U of T4 ssRNA Ligase 1 (NEB) in a final volume of 50 μl for 1 h at 37°C and 1X T4 of RNA Ligase Reaction Buffer (NEB ...
-
bioRxiv - Biochemistry 2020Quote: ... The region harboring the randomized hexamer and flanking constant tags was amplified from 1 µg ssDNA for 5 cycles using the Q5 Hot Start High-Fidelity PCR Master Mix (New England Biolabs) and the following primers ...
-
bioRxiv - Systems Biology 2020Quote: ... we first phosphorylated the 5’ ends of each probe set by combining 4 μL of the pooled oligos with 1 μL T4 PNK (NEB), 20 μL T7 DNA ligase reaction buffer (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... The hygR insert and the inverse PCR product of the pEX18Ap backbone were mixed at a 5:1 ratio and ligated for 30 minutes at 50°C with New England Biolabs (NEB) Gibson Assembly ® Cloning Kit to create pEX18HygB ...
-
bioRxiv - Genomics 2022Quote: ... The TdT reation was prepared using 4 μL of the resulting elutant and 5 μL of ice-cold TdT mix (standard Quartz-seq2 condition: 1× Thermopol buffer [New England Biolabs] ...
-
bioRxiv - Biochemistry 2022Quote: We assembled mutant libraries by combining the linearized sensor backbone with each oligo subpool at a molar ratio of 1:5 using Golden Gate Assembly Kit (New England Biolabs; 37 °C for 5 min and 60 °C for 5 min ...
-
bioRxiv - Plant Biology 2022Quote: ... The vector and insert DNA fragments were assembled in a ratio of 1:5 using NEBuilder HiFi DNA Assembly (E5520S, New England Biolabs). The gl2L480P ...
-
bioRxiv - Cell Biology 2021Quote: ... COS-7 cell lysates from FLAG-ACBD4/5 (mFFAT) expressing cells were treated for 1 h with λPP (New England BioLabs) as described above ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 1-5 uL of the cDNA product was PCRed with Phusion Hot Start Flex DNA Polymerase (New England BioLabs, M0535S), using a barcoded version of SGR-176 and a version of the 10x Genomics cDNA primer that included a P5 addition ...
-
bioRxiv - Genomics 2021Quote: The supernatant was magnetically removed and the beads were resuspended in 20 µl of L3 DNA linker ligation mixture (8 µl water, 5 µl 4X ligation buffer, 1 µl RNA ligase [New England Biolabs] ...
-
bioRxiv - Genomics 2021Quote: ... “Fuorf_RNA_adapter” was ligated to the 3’ end of 10 μl of cDNA in a 20 μl reaction at 65 °C for 1 hour using Thermostable 5’ App DNA/RNA ligase (New England Biolabs). The reaction was inactivated at 95 °C for 3 minutes and 2 μl of the reaction was used as a template for PCR for sequencing library generation as described below.
-
bioRxiv - Physiology 2021Quote: ... ChIP-seq libraries were prepared from 1 to 5 ng eluted DNA using NEBNext Ultra II DNA library Prep Kit (New England BioLabs), with 12 cycles of library amplification ...
-
bioRxiv - Immunology 2020Quote: ... cDNA synthesised with SMARTNNN oligos were treated with 1 μl of Uracil DNA glycosylase (5 U/μl, New England Biolabs) and incubated for 15 minutes at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... Gel extracted DNA fragments were incubated in a ratio of 1:3 of plasmid to insert (1:5 for inserts smaller than 300 nucleotides) in the presence of Gibson Assembly master mix (NEB) at 50°C for 1 hour.
-
bioRxiv - Molecular Biology 2021Quote: ... 0.5–1 μg of circFL-seq cDNA was repaired and dA-tailed by the NEBNext FFPE DNA Repair Mix (NEB) and NEBNext Ultra II End repair/dA-tailing Module (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3′ RNA adaptor (/5Phos/NNNNNNNNGAUCGUCGGACUGUAGAACUCUGAAC/3InvdT/) is ligated at 5 μM concentration for 1 hours at room temperature using T4 RNA ligase (NEB), followed by 2 consecutive streptavidin bead bindings and extractions ...
-
bioRxiv - Molecular Biology 2022Quote: ... 20 pmol of dephosphorylated and purified RNA was 5′ end-labeled (20 μCi of 32P-γATP) using 1 U of Polynucleotide Kinase (NEB) for 1 h at 37 °C in a 20 μL reaction volume ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μL of the DNAse digestion product was then treated with 1 μL of Proteinase K (New England Biolabs, P8107S) in UltraPure water for a total reaction volume of 20 μL ...
-
bioRxiv - Microbiology 2024Quote: The ectodomains of the hemagglutinin proteins from selected influenza virus strains were ordered as synthetic DNA fragments from Twist Biosciences and cloned with a barcoded fragment encoding the last 46 amino acids of WSN HA as 3-segment assembly reaction into a construct containing the 3’ non-coding region of the packaging signal and signal peptide from A/WSN/1933 influenza HA and the a Read 1 Illumina sequence and the full 5’ packaging signal from A/WSN/1933 virus using Hifi Assembly Mastermix (NEB). The backbone for this cloning reaction was a pHH21 plasmid (16 ...
-
bioRxiv - Microbiology 2024Quote: ... The radioactive probe was prepared from 40 pmoles of D072 primer (Table 1) and labeled at the 5’ end with 10 units of T4 polynucleotide kinase (New England Biolabs) and [γ-32P]-ATP (150 μCi) ...
-
bioRxiv - Genomics 2023Quote: ... 5′-Tru-Seq small RNA adapters were ligated on to the de-capped RNA with T4 RNA Ligase 1 (NEB) in the presence of ATP and cDNA synthesized following Illumina small RNA-seq protocol ...
-
bioRxiv - Biophysics 2024Quote: We assembled mutant libraries by combining the linearized sensor backbone with each oligo subpool at a molar ratio of 1:5 using Golden Gate Assembly Kit (New England Biolabs; 37 ◦C for 5 min and 60 ◦C for 5 min ...
-
bioRxiv - Microbiology 2023Quote: ... The dephosphorylated RNA (20 pmol) was then 5′-labelled (20 µCi of 32P-γATP) with 1 U of polynucleotide kinase (NEB) for 1 h at 37 °C ...
-
bioRxiv - Plant Biology 2024Quote: ... One µL of the end- prepped DNA was amplicons were barcoded with 1 µL of Nanopore Native Barcode using 5 µL Blunt/TA ligase master mix (NEB) in total reaction volume of 10 µL for 20 min at 20 °C ...
-
bioRxiv - Bioengineering 2022Quote: ... Transcription was initiated upon addition of 4 nM of dsDNA template (gblocks Gene Fragment, IDT) to a solution of 5 U.μL-1 of T7 RNA polymerase (NEB, M0251), 1 U.μL-1 of murine RNase Inhibitor (NEB M0314) ...
-
bioRxiv - Immunology 2022Quote: ... Resulting mRNA products were capped with a 5’-Cap 1 structure using vaccinia capping enzyme (New England Biolabs, Ipswitch, MA) and Vaccinia 2’ O-methyltransferase (New England Biolabs) ...
-
bioRxiv - Genetics 2022Quote: ... ChIP-seq libraries were prepared from 1 to 5 ng eluted DNA using NEBNext Ultra II DNA library Prep Kit (New England Biolabs) with 12 cycles of library amplification.
-
bioRxiv - Molecular Biology 2023Quote: ... 20 pmol of this RNA was 5’-end-labelled (20 µCi of 32P-γATP) using 1 U of polynucleotide kinase (NEB) at 37°C for 1 h in a 20 µL reaction ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNase-treated RNA was ligated with a 5’-hydroxylated ‘Processed Start Site’ (PSS) RNA adaptor oligomers (onkh031) by RNA Ligase 1 (Promega or NEB) and then purified to remove excess oligomers (NEB Monarch RNA Cleanup kit) ...
-
bioRxiv - Molecular Biology 2022Quote: ... the RNA was ligated to the 5’ adaptor from IDT (ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised) using the T4 RNA Ligase 1 (NEB). Adaptor-ligated RNA was reverse-transcribed by SuperScript II and amplified by KAPA polymerase using the same primers as for the RNA sequencing.
-
bioRxiv - Cell Biology 2023Quote: ... Ni-NTA-bound SPD-5 was incubated for 1 hr at room temperature in dephosphorylation buffer (1X PMP buffer (NEB) + 1mM MnCl2 ...
-
bioRxiv - Cell Biology 2023Quote: ... Ni-NTA-bound SPD-5 was incubated for 1 hr at room temperature in dephosphorylation buffer (1X PMP buffer (NEB) + 1mM MnCl2 ...
-
bioRxiv - Cell Biology 2024Quote: ... ABHD17A mutant plasmids (plasmids 5-21 in Supplementary Table 1) were made with NEBuilder HiFi DNA Assembly (New England Biolabs), using primers (Supplementary Table 2 ...
-
bioRxiv - Microbiology 2024Quote: ... The RT reaction was diluted 2-fold with nuclease free water and 1 μl of the diluted mix was subjected to 5’ RACE PCR using Q5 polymerase (NEB) with a touchdown PCR protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... the RNA was ligated to the 5’ adapter from IDT (ACACUCUUUCCCUACACGACGCUCUUCCGAUCUNNNN where Ns are randomised) using the T4 RNA Ligase 1 (NEB). Adapter-ligated RNA was reverse-transcribed using SuperScript II (Thermo Fisher ...
-
bioRxiv - Genomics 2024Quote: ... were then applied to the slide and the sample was digested using 5 µg/mL-1 endoproteinase Glu-C (New England Biolabs) at 40°C for 15 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 89 nt product was phosphorylated with T4 PNK and a final 20 nt RNA oligo with sequence GGCUUCGCAGUCCUUAGAAG (Chemgenes) was ligated to the 5’ end of the 89 mer using T4 RNA Ligase 1 (NEB). Finally ...
-
bioRxiv - Neuroscience 2024Quote: ... and nuclease-free water in a 5:10:1:34 ratio) supplemented with 0.8 U/µl Proteinase K (NEB P8107S) for 48-72 hours in a humidified 37 °C incubator.
-
bioRxiv - Systems Biology 2024Quote: ... Both the DNA libraries and the pBAD33 plasmid backbone were then gel-purified and used for a ligation reaction in 5:1 molar ratio using the T4 DNA ligase (NEB). After PCR-purification of the ligation ...
-
bioRxiv - Biochemistry 2024Quote: 5 uL of GFP conditioned medium or 1 ug of each purified antibodies was treated with PNGase-F (NEB, P0704L) or Endo-H (NEB ...
-
bioRxiv - Genomics 2024Quote: ... 1: 120) diluted in the hybridization buffer (10% deionized formamide, 2X SSC, 100mg tRNA, 5% dextran sulfate, 2mM VRC (NEB), 0,2mg/mL BSA) ...
-
bioRxiv - Developmental Biology 2020Quote: ... oligonucleotides for the HAS-1 or HAS-2 sgRNA guide sequences were phosphorylated using T4 PNK (NEB, Ipswich, MA) for 30 min at 37°C ...
-
Nonsense Mediated RNA Decay Is a Unique Vulnerability of Cancer Cells with SF3B1 and U2AF1 MutationsbioRxiv - Cell Biology 2021Quote: ... Genomic DNA (2 μg) was then treated with buffer alone or with 1 unit RNase H enzyme (NEB, MO297S) for 2 hours at 37 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... doner RNA and the complementary splint DNA strand were annealed at a molar ratio of 1: 2: 1.5 in T4 DNA ligase buffer (NEB) by incubation for 3 min at 65°C ...
-
bioRxiv - Neuroscience 2022Quote: ... RNP complex were generated by mixing 1 μg of sgRNA with 2 μM of EnGen SpyCas9 NLS (NEB, M0646) at room temperature for 15-20 min ...
-
bioRxiv - Microbiology 2022Quote: ... the cap-1 structure was added using the vaccinia virus capping enzyme and 2’-O-methyltransferase (New England Biolabs). The mRNA was purified by oligo-dT affinity purification ...