Labshake search
Citations for New England Biolabs :
7201 - 7250 of 9943 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2024Quote: ... followed by RNA purification using a Monarch RNA Cleanup Kit following the manufacturer’s protocol (New England Biolabs, Whitby, ON, Canada). One-day old male and female adult mosquitoes were briefly anesthetized using CO2 and injected in the thorax with 1 μg of AedaeItp ...
-
bioRxiv - Microbiology 2023Quote: ... Libraries for sequencing were prepared using a NEBNext Ultra II FS DNA library prep kit for Illumina modules E7810L and E7595L (New England BioLabs) by the manufacturer’s protocol (DNA input ≥100 ng ...
-
bioRxiv - Biochemistry 2024Quote: ... reverse 5’-GTGGCC CTCGAG TCA GTG AGT TTC ATG TTG G-3’ and then purified using the Monarch PCR plus DNA purification kit (NEB). The purified PCR product was digested by KpnI and XhoI (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR was performed using primers containing the homology arm flanking the sgRNA region (replacing the BRD4 homology arm) and Gibson cloned (NEBuilder Hifi DNA assembly kit, NEB) into the same vector by digesting with MluI restriction enzyme.
-
bioRxiv - Cell Biology 2024Quote: ... Total RNA libraries were constructed using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England BioLabs, #E7760) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... The sequencing library was generated by combining equal amounts of purified PCR products and quantified using the NEBNext Library Quant Kit for Illumina (New England Biolabs). The primer 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTTTGTGGAAAGGACGAAACACCG-3’ was used to sequence on Illumina platforms.
-
bioRxiv - Molecular Biology 2024Quote: ... The CHD4-GFP mutant was cloned with selective primers (fwd, 5’-GGATGCTACAGGTGGAACCCTGCACCCCTA-3’; rev, 5’-GCCCAGGCCCGACGCCAT-3’) and a Q5 site-directed mutagenesis kit (NEB) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries for DNA fragments were prepared based on the NEBNext Ultra II DNA library prep Kit for Illumina (NEB#E7645).
-
bioRxiv - Molecular Biology 2024Quote: ... 25ul ChIP DNA or 10ng Input DNA were used to generate libraries using the NEBNext Ultra II Library Prep Kit for Illumina (NEB). Reactions were scaled down to half otherwise processing was according to the manufacturer’s manual ...
-
bioRxiv - Molecular Biology 2024Quote: ... The repair template was assembled and integrated into pCC1 using Gibson assembly (Gibson et al., 2008) (NEB Hifi assembly kit). Colony PCR was used to check the plasmids had the correct inserts (F-93/R-91 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 72mer Ψ-containing model RNA used for mutation analysis and the 1.8-kb 10% Ψ-modified RNA used for UHPLC-MS/MS were prepared by T7 in vitro transcription using HiScribe T7 High Yield RNA Synthesis Kit (NEB) and Pseudo-UTP (Jena Bioscience ...
-
bioRxiv - Molecular Biology 2024Quote: ... T7 promoter region was added to the 5’ end of each construct for in vitro transcription of RNA using T7 RNA polymerase from T7 HiScribe RNA synthesis kit (New England Biolabs). Synthesized RNA was subjected to DNase treatment (TURBODNase ...
-
bioRxiv - Molecular Biology 2024Quote: SINV was produced from pT7-SVwt plasmid90 that was first linearized with XhoI and purified to use it as a template for in vitro RNA transcription with HiScribe T7 ARCA mRNA kit (NEB). Transcribed viral RNA was transfected into BHK-21 using Lipofectamine 3000 reagent (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... The HIV-1AC-1 mutations were introduced into WT and N74D pNLdE-luc using the Gibson Assembly Cloning kit (New England Biolabs) and primers shown in Table S1 ...
-
bioRxiv - Microbiology 2024Quote: ... from HIV-1 infected cells was digested and ligated with linkers using the NEBNext Ultra II FS DNA Library Prep Kit (New England Biolabs) and its associated protocol ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR products were used to constructed libraries using NEB Next Ultra DNA Library Prep Kit for Illumina (NEB, USA) following manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2024Quote: ... Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT) within loxP-N with the lox17:2272 site (ATAACTTCGTATAGGATACTTTATAGCAATTTAT) using a Q5 Site-Directed Mutagenesis kit (New England Biolabs) and PCR ...
-
bioRxiv - Molecular Biology 2024Quote: High molecular weight genomic DNA was extracted from homozygous hDMDTg and hDMDTgSc mice liver using the Monarch HMW DNA Extraction Kit for Tissue (NEB). Oxford Nanopore Technologies Promethion genome sequencing was performed as a service by Novogene ...
-
bioRxiv - Neuroscience 2024Quote: ... DNA fragments were generated by PCR amplification and then fused with the backbones using NEBuilder HiFi DNA assembly kit (New England Biolabs). Resulting plasmids were verified by sequencing (GeneWiz).
-
bioRxiv - Microbiology 2024Quote: Plasmid pET28bR109H for overexpression of the R109H mutant was obtained by site-directed mutagenesis of plasmid pET28bRho (kindly provided by Pr. James Berger, Johns Hopkins University) using the NEBuilder HiFi kit (New England Biolabs). The R109H mutant was overexpressed in BL21(DE3)pLysS cells carrying the pET28bR109H plasmid and purified as described for WT Rho 105.
-
bioRxiv - Microbiology 2024Quote: ... Libraries for Illumina sequencing (average insert size: 700 bp) were prepared using the NEBNext Ultra II FS DNA Library Prep Kit (New England Biolabs) and sequenced using Illumina MiSeq to generate 300 bp paired-end reads ...
-
bioRxiv - Molecular Biology 2024Quote: ... were PCR-amplified and subcloned into the Halo pcDNA5/FRT vector using Gibson Assembly Cloning Kit [New England Biotechnologies (NEB)] ...
-
Spatial visualization of A-to-I Editing in cells using Endonuclease V Immunostaining Assay (EndoVIA)bioRxiv - Molecular Biology 2024Quote: ... Cells were lysed and total RNA was isolated and purified using the Monarch Total RNA Miniprep Kit (New England BioLabs). This purified RNA was then used to prepare sequencing libraries with the Tru-Seq Stranded with RiboZero Gold (Human/Mouse/Rat ...
-
bioRxiv - Molecular Biology 2024Quote: ... the UGI in pYPQ265E2 was replaced by 2xUGI using the NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs®) to generate A3A-Y130F-nzCas9-2xUGI ...
-
bioRxiv - Molecular Biology 2024Quote: ... digested by NheI and BamHI were jointed together with 15-20 bp overlapping sequences using the NEBuilder HiFi DNA Assembly Cloning Kit (NEB).
-
bioRxiv - Developmental Biology 2024Quote: ... Barcoded libraries were made with NEBNext Ultra II DNA Library Prep Kit for Illumina) using NEBNext Multiplex Oligos Dual Index Primers for Illumina (New England BioLabs) and sequenced on NextSeq2K (Illumina ...
-
bioRxiv - Neuroscience 2024Quote: ... were generated from a pENTR cyfip2-EGFP plasmid [32] using custom primers and the Q5 Site Directed Mutagenesis Kit (NEB) to induce the desired C179R (ΔRac1 ...
-
bioRxiv - Neuroscience 2024Quote: ... a V5 tag was inserted after the start codon of Ten-m cDNA (isoform B) in the plasmid pUAST-attB-Ten-m5 using the Q5 site-directed mutagenesis kit (New England Biolabs). To generate the UAS-V5-Ten-m-ΔICD and UAS-V5-Ten-m-ΔECD constructs ...
-
bioRxiv - Neuroscience 2024Quote: ... Silent mutations were introduced at the PAM site of the HDR vector by using the Q5 site-directed mutagenesis kit (New England Biolabs). The APEX2-V5-Ten-m HDR and the Ten-m gRNA vectors were co-injected into vas-Cas9124 fly embryos by BestGene ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA was synthesized from 500ng RNA using a Multiscribe High Capacity cDNA Synthesis kit (Thermo) and qPCR was performed using Luna qPCR Master Mix (New England Biolabs) against primers listed in table 2.
-
bioRxiv - Microbiology 2024Quote: Amino acids substitutions in ompT were generated using the Q5® Site-Directed Mutagenesis Kit (New England Biolabs, Ipswich, MA). Briefly ...
-
bioRxiv - Microbiology 2024Quote: ... PolyA+ RNA was purified from ∼100 ng of total RNA and sequencing libraries were prepared with the NEBNext Ultra II RNA library kit (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: Quantification of SARS-CoV-2 E gene subgenomic mRNA (sgmRNA) was conducted using Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a Step One Plus Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2024Quote: ... The scFv DNA (256 ng) was ligated into the phagemid vector (400 ng) using the T4 Ligase Kit (New England BioLabs) in 25 × 40 μl reactions and incubated at 16°C overnight ...
-
bioRxiv - Microbiology 2024Quote: ... On-bead PCR indexing-amplification was performed using custom-ordered indexing primers (IDT) matching the Illumina Nextera Index Kit sequences and 2x Phusion Master Mix (NEB). PCR reactions were amplified for 9-11 cycles ...
-
bioRxiv - Microbiology 2024Quote: To test the binding affinity of the TBT and TBTG mRNA to the 30S ribosomal subunit we used PURExpress ΔRibosome Kit (NEB) supplemented with 5 μM of 30S ribosomal subunit and 10 μM tRNAfMet in the presence of 1.4 μM of radioactively labelled mRNA (prepared as described above by in vitro translation followed by [32P] labelling as described for the northern blot probe labelling) ...
-
bioRxiv - Microbiology 2024Quote: ... Genes of interest were PCR amplified to include either their native or heterologous promoter and cloned using Gibson Assembly kit (NEB) into integration vectors pDG1662 (for insertion into the amyE locus) ...
-
bioRxiv - Cell Biology 2024Quote: THP-1 monocytes were harvested and lysed for RNA extraction using the Monarch Total RNA Miniprep kit (New England Biolabs), according to the manufacturer protocol ...
-
bioRxiv - Developmental Biology 2024Quote: Reporter gene fusions for cis-regulatory analysis were made using either PCR fusion or Gibson Assembly Cloning Kit (NEB #5510S) 88 ...
-
bioRxiv - Cell Biology 2024Quote: ... Library preparation was slightly different and performed using the NEBNext® rRNA Depletion kit and protocol (NEB; P/N: E7850X) per manufacturer recommendations ...
-
bioRxiv - Biophysics 2024Quote: We assembled mutant libraries by combining the linearized sensor backbone with each oligo subpool at a molar ratio of 1:5 using Golden Gate Assembly Kit (New England Biolabs; 37 ◦C for 5 min and 60 ◦C for 5 min ...
-
bioRxiv - Biophysics 2023Quote: ... all KIF5B mutations and truncations were made through substitution with gene fragments from IDT via HIFI DNA assembly kit (NEB) in a KIF5B mammalian expression vector ...
-
bioRxiv - Biophysics 2023Quote: ... The full length KIF5B in pACEBac1 was replaced with a C-terminal TEV-Twin-Strep-tag via HIFI DNA assembly kit (NEB). The TRAK1 construct was made through assembling His-ZZ-TEV-SNAP tag and TRAK1(1-395 ...
-
bioRxiv - Plant Biology 2023Quote: ... EM-seq libraries were prepared from sheared DNA using an enzymatic methyl-seq kit following the standard instructions (New England BioLabs), and were subjected to NextSeq550 using 75bp paired-end sequencing ...
-
bioRxiv - Biochemistry 2023Quote: ... and cloned into BamHI- and XhoI-digested pcDNA5/FRT vector using the NEBuilder HiFi DNA Assembly kit (New England Biolabs). The resultant construct ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA of the best quality from three replicates of each experiment were used for preparation of cDNA libraries for NGS using NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... 50μl of sample was used for library preparation with the NEB Ultra DNA library kit (New England Biolabs, cat# E7370S). Barcoded samples were sequenced with a NextSeq500 2x150bp high output run ...
-
bioRxiv - Plant Biology 2023Quote: ... Chemical fragmentation of ligated RNA to ≤200nt was performed using the Magnesium RNA fragmentation kit (New England Biolabs, cat#E6150S). 2ul RNA Fragmentation Buffer was added and samples were incubated at 94°C for 5 minutes followed by a transfer to ice and the addition of 2μl of RNA Stop solution ...
-
bioRxiv - Developmental Biology 2024Quote: ... Complementary DNA (cDNA) was prepared from total RNA (5 μg) by reverse transcription using LunaScript® RT SuperMix Kit (NEB). qPCR reactions were performed using Power SYBR Green Master Mix (Thermo ...
-
bioRxiv - Cell Biology 2024Quote: ... domain from pmEGFP-N1-R-MCD(+0.2) plasmid (kind gift from Dr. Gregory Jedd) and cloned into XLone-GFP plasmid using Gibson assembly kit (NEB, E2611S). Two days after nucleofection ...