Labshake search
Citations for New England Biolabs :
7201 - 7250 of 8151 citations for 6H Pyrazolo 3 4 b pyridin 6 one 3 cyclobutyl 1 2 4 5 tetrahydro 4 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2019Quote: ... at a ratio of 1:40 using 0.5 µL of Q5 High-Fidelity DNA Polymerase (NEB, M0491S) in a 50 µL reaction containing 1x Q5 polymerase reaction buffer (NEB ...
-
bioRxiv - Plant Biology 2019Quote: 1 μg sheared DNA fragments were end-repaired with Ultra II End-prep enzyme mix (E7546L, NEB) for 5 minutes at 20°C and 5 minutes at 65°C using a thermal cycler ...
-
bioRxiv - Cell Biology 2019Quote: ... then incubated with either mouse anti-MBP antibodies at a dilution of 1:5000 (New England Biolabs) or 1:2500 mouse anti-GFP antibodies (Roche ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Sequences were indexed using the NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1, NEB #E7600). We sequenced paired end libraries at the Institute for Biotechnology at Cornell University ...
-
bioRxiv - Biochemistry 2020Quote: ... treated with lambda phosphatase protein after purification at 30°C for 1 hr (New England BioLabs, P0753L), or co-expressed in BL21 cells with RFP-lambda phosphatase ...
-
bioRxiv - Bioengineering 2020Quote: Total RNA was extracted from 1 million cells using the Monarch Total RNA Miniprep Kit (NEB, #T2010S). We prepared cDNA from 1 μg of extracted RNA using LunaScript® RT SuperMix Kit (NEB ...
-
bioRxiv - Bioengineering 2020Quote: ... We prepared cDNA from 1 μg of extracted RNA using LunaScript® RT SuperMix Kit (NEB, #E3010). No Template and No Reverse Transcriptase controls (NTC and NRT ...
-
bioRxiv - Bioengineering 2020Quote: Genomic DNA was prepared from 1 million cells using the Monarch Genomic DNA Purification Kit (NEB, #T3010G). Diagnostic PCR was then carried out followed by gel extraction (NucleoSpin ...
-
bioRxiv - Neuroscience 2020Quote: ... Plasmid DNA was digested for 1 hour at 37°C with NcoI (New England BioLabs, Ipswich, MA) unless otherwise specified in a final volume of 20 μl before evaluating restriction fragment patterns by 1% agarose gel electrophoresis ...
-
bioRxiv - Biophysics 2021Quote: Time-resolved experiments with TEV protease were performed by adding 1 μL TEV protease (New England Biolabs) after the 3rd time point to an imaging well containing 100 μL protein sample ...
-
bioRxiv - Biochemistry 2020Quote: ... and 20 µL of 20 U/µL MNase (New England BioLabs, 1/1000 dilution of commercial stock). Reactions were digested for 1 minute and quenched with 2 µL 500 mM EDTA and thorough pipetting ...
-
bioRxiv - Microbiology 2020Quote: ... The supernatant was incubated with gentle shaking for 1 h with 10 mL of amylose resin (NEB) pre-equilibrated in 50 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μg of RNA isolate was subjected to rRNA removal with the NEBNext rRNA Depletion Kit (NEB) using the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2020Quote: ... PCR reactions were set up with 1 μL of genomic DNA and either Q5 DNA Polymerase (NEB) or LongAmp Taq (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... 0.5-1 μg of total RNA was reverse transcribed using Protoscript II Reverse Transcriptase (New England Biolabs). Quantitative real-time PCR was carried out using the Light-Cycler 480 SYBR Green I Master (Roche) ...
-
bioRxiv - Biophysics 2022Quote: ... The pooled PCR products were incubated at a 10:1 ratio with DpnI enzyme (New England Biolabs) at room temperature for 5 min ...
-
bioRxiv - Biophysics 2022Quote: Cells used for calcium imaging experiments were labeled using 1 µM SNAP-Surface Alexa Fluor 647 (NEB) and 4 µM Oregon Green 488 BAPTA-1 (Fisher Scientific ...
-
bioRxiv - Genomics 2022Quote: ... Permeabilized cells were then digested with a final concentration of 1 U/μL of NlaIII (NEB-R0125L) and brought to volume with nuclease-free water to achieve a final 1X digestion reaction buffer in 450μL ...
-
bioRxiv - Neuroscience 2021Quote: ... for samples from library #1 and the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB) for samples from library #3 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Total mRNA was prepared from 1 μg total RNA using poly(A) mRNA magnetic isolation reagents (NEB) and fragmented at 94 °C for 15 min ...
-
bioRxiv - Genetics 2019Quote: ... After washing the pellet two times with 1ml of 1 × NEB buffer 2.1 (New England BioLabs (NEB), USA) ...
-
bioRxiv - Cancer Biology 2021Quote: pLenti CMV Hygro DEST (w117-1) was digested with SalI and BamHI (New England BioLabs Inc., MA) according to manufacturer instructions ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from 1 million cells using the Monarch Total RNA Miniprep Kit (NEB, #T2010S). We prepared cDNA from 1μg of extracted RNA using LunaScript® RT SuperMix Kit (NEB ...
-
bioRxiv - Genomics 2021Quote: ... 10 ng A-tailed gel-isolated PCR product and 1 µl T4 DNA ligase (New England Biolabs) were mixed in a total reaction volume of 10 µl and incubated for 15 min at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μL 10 μM NEBNext Index Primer (NEB E7335, NEB E7500, NEB E7710, NEB E7730, NEB E6609), 1 μL 10 μM NEBNext Universal PCR Primer in 20 μL total volume ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μL 10 μM NEBNext Index Primer (NEB E7335, NEB E7500, NEB E7710, NEB E7730, NEB E6609), 1 μL 10 μM NEBNext Universal PCR Primer in 20 μL total volume ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μL 10 μM NEBNext Index Primer (NEB E7335, NEB E7500, NEB E7710, NEB E7730, NEB E6609), 1 μL 10 μM NEBNext Universal PCR Primer in 20 μL total volume ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μL 10 μM NEBNext Index Primer (NEB E7335, NEB E7500, NEB E7710, NEB E7730, NEB E6609), 1 μL 10 μM NEBNext Universal PCR Primer in 20 μL total volume ...
-
bioRxiv - Immunology 2020Quote: ... The amplified DNA was then treated with recombinant Shrimp Alkaline Phosphatase and Exonuclease 1 (New England Biolabs), and sent to ELIM Biopharm for sequencing ...
-
bioRxiv - Genetics 2019Quote: ... After washing the pellet two times with 1ml of 1 × NEB buffer 2.1 (New England BioLabs (NEB), USA) ...
-
bioRxiv - Genomics 2021Quote: The GCG1/SUT098 FPR plasmid was digested with AvrII and BglII (1 U per µg plasmid, NEB) restriction enzymes to excise the NatMX6 cassette ...
-
bioRxiv - Genomics 2021Quote: ... and resuspended in 1 x DPBS with 0.4 mg/ml bovine serum albumin (# 74719, New England Biolabs) at approximately 1000 cells/µl ...
-
bioRxiv - Genomics 2021Quote: ... 8.5 µL of this phosphorylated product was combined with 1 µL of 10X T4 ligase buffer (NEB) and 0.5 µL of T4 DNA ligase (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... The primary antibodies used in this study were rabbit anti-GLuc 1:2,000 (E8023S, New England Biolabs), rabbit anti-epidermal growth factor receptor (EGFR) ...
-
bioRxiv - Genomics 2021Quote: ... The digested sample was diluted with 400 µL T4 ligation buffer (NEB, M0202, 1% Triton X-100) and incubated at 37°C for 30 min ...
-
bioRxiv - Immunology 2020Quote: ... mRNA was isolated from purified 1 ng total RNA using oligo-dT beads (New England Biolabs, Inc). NEBNext Ultra™ RNA kit was used for full-length cDNA synthesis and library preparation ...
-
bioRxiv - Biochemistry 2021Quote: ... 1 µL of the purified product was ligated into a circular plasmid using KLD reaction mix (NEB) incubated for 10 min at room temperature.
-
bioRxiv - Biochemistry 2021Quote: ... with and without the addition of ACE2 (~1:1.25 S-protein trimer:ACE2 molar ratio) (New England Biolabs). Vitrified samples of S-protein constructs with and without ACE2 were prepared by first glow discharging Quantifoil R1.2/1.3 300 mesh holey carbon copper grids for 1 minute using a Pelco easiGlow glow discharge unit (Ted Pella ...
-
bioRxiv - Biochemistry 2021Quote: Radiolabeling of oligonucleotides was carried out for 1 h at 37 °C using T4 polynucleotide kinase (NEB), 0.25 μM oligonucleotide ...
-
bioRxiv - Microbiology 2021Quote: ... then heat inactivated at 65°C for 30 minutes and ligated using 1 µl Quick Ligase (NEB) at room temperature for 15 minutes ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1 μl of Protoscript II Reverse Transcriptase (200 U/μl, Catalog No. M0368, New England BioLabs Inc.), 2 μl of 0.1M dithiothreitol (DTT) ...
-
bioRxiv - Microbiology 2021Quote: ... 1 µl from the supernatant was used for a 20 µl PCR reaction with Phusion polymerase (NEB), using primers oLGB21 (TGGGAGCAAGTTTTCTGAATTTGG ...
-
bioRxiv - Microbiology 2021Quote: ... and 10 μl of 2x Quick T4 ligase buffer and 1 μl Quick T4 DNA ligase (NEB) were added and incubated at room temperature overnight ...
-
bioRxiv - Plant Biology 2021Quote: The pGEX6P-1 vector (Cytiva, Tokyo, Japan) was digested with SalI-HF (New England Biolabs, Tokyo, Japan). Alleles of MvALS1/2/3/5 from the sensitive population (SMM13 ...
-
bioRxiv - Genomics 2020Quote: ... 50ng digested px330 was mixed with 1:250 diluted oligo duplex with 2X quick ligation buffer (NEB) and quick ligase (NEB ...
-
bioRxiv - Molecular Biology 2019Quote: RNA digestion of 20 OD260nm of cell extracts were performed by using 1 unit of Xrn1 (Biolabs) in NEB buffer 3 at 25°C during 30 min unless otherwise indicated ...
-
bioRxiv - Biophysics 2020Quote: 1 μg purified full length hGHR was incubated with 500 units of Endo-H (New Biolabs, USA) at 4 °C in 20 mM NaH2PO4/Na2HPO4 (pH 7.4) ...
-
bioRxiv - Microbiology 2022Quote: Ten μg of total DNA were digested with 1 μL of MmeI restriction enzyme (New England Biolabs) in 250 μL total volume with 10 μL of S-adenosyl methionine (SAM ...
-
bioRxiv - Microbiology 2022Quote: ... 10 min) and resuspended in 50 µl of 50 mM Tris-HCl containing 1 µg trypsin (NEB). After overnight incubation at 37 °C ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA were synthesised from 1 µg RNA by reverse transcription using LunaScript RT SuperMix Kit (NEB; E3010). qRT-PCR was performed using Luna Universal qPCR Master Mix (NEB ...