Labshake search
Citations for New England Biolabs :
6951 - 7000 of 10000+ citations for Mouse Tyrosinase Related Protein 1 TYRP1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... The cDNA library was prepared using the NEBNext Ultra Directional RNA Library Prep Kit (#E7420, New England BioLabs) for Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... Libraries were prepared using NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB #E7645L) following manufacturer’s instructions and NEB Next Multiplex Oligos for Illumina (96 Index Primers ...
-
bioRxiv - Cancer Biology 2019Quote: ... cDNA libraries were prepared using NEBNext® Ultra™ RNA Library Prep Kit for Illumina (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... Sequencing libraries were prepared with NEBNext® UltraTM II kit for Illumina (cat# E7645S) (New England Biolabs, MA) and exomes were captured with SSELXT Human All exon V6 +UTR probes (Agilent Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... an NLS sequence was inserted downstream of the TagRFP sequence in the Cb expression vector described above with primers nls-insert_for and nls-insert_rev using the Q5 Site-Directed Mutagenesis Kit (NEB) and the resulting plasmid was used as a template to subsequently amplify the TagRFP-NLS sequence using the primers frag3-tRFP-nls_for and frag3-tRFP-nls_rev ...
-
bioRxiv - Plant Biology 2021Quote: ... The K107E and ΔSTART mutations in PDF2 were generated using Q5 Site-Directed Mutagenesis Kit (New England Biolabs). The L480P mutation in GL2 was generated by one-step PCR-based site-directed mutagenesis (Scott et al. ...
-
bioRxiv - Plant Biology 2021Quote: ... total RNA was extracted using Monarch Total RNA Miniprep kit including DNAse treatment on column (New England Biolabs). m7G-RIP was then performed as previously described49 with slight modifications ...
-
bioRxiv - Biochemistry 2020Quote: ... Amino acid substitutions were made using the Q5 Site-directed Mutagenesis kit (New England Biolabs, Ipswich, MA, USA) to generate pNG309 and pNG307 for expression of xoxF1 D320A and exaF D319S ...
-
bioRxiv - Microbiology 2020Quote: ... Catalytically inactive Mt2 (Mt2 C78A) variant was generated via site-directed mutagenesis (NEB, Q5 Site-Directed Mutagenesis Kit) using primers listed in the primer table (Supplementary Table 1) ...
-
bioRxiv - Microbiology 2020Quote: ... Libraries were created using NEBNext® Ultra(tm) Directional RNA Library Prep Kit (New England BioLabs, Frankfurt, Germany). Pooled libraries were loaded on the cBot (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... DNA libraries were prepared using the NEB Next Ultra DNA Library Prep kit for Illumina (New England BioLabs). Approximately 10 Gb were sequenced with a HiSeq X Ten instrument as paired-end 150 bp reads ...
-
bioRxiv - Microbiology 2020Quote: ... cDNAs were synthesized from RNA using the LunaScript™ RT SuperMix Kit from New England BioLabs (NEB, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... then RNA-seq libraries were prepared using the NEBNext Ultra II Directional mRNA-seq kit (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2021Quote: ... Ribo-depleted RNA was then prepared for sequencing using the NEBNext Ultra Directional RNA kit (NEB product E7420), and sequenced as described above for the DNA samples.
-
bioRxiv - Cancer Biology 2020Quote: ... site-directed mutagenesis was carried out using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs, Cat# E0554S) to introduce a stop codon ...
-
bioRxiv - Plant Biology 2021Quote: ... the mutations were generated in pBridge-PIF3-N1 with the Q5 Site-Directed Mutagenesis Kit (New England BioLabs). The primers used to generate the m1 to m15 mutants are listed in Supplementary Table 2 ...
-
bioRxiv - Systems Biology 2020Quote: ... The NCK2 SH3 shuffled chimeras were constructed using NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs, Inc). The different functional regions of NCK2 are based on NCBI (NP_035009.3 ...
-
bioRxiv - Microbiology 2020Quote: ... Sequencing libraries were generated using NEB Next® Ultra™ DNA Library Prep Kit for Illumina (NEB, USA) following manufacturer’s recommendations and index codes were added ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Genomics 2021Quote: Final libraries were prepared on beads using the NEB-Next Ultra II DNA Library Prep Kit (NEB, #E7645) as follows ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA sequencing libraries were created using the NEBNext Ultra II Directional RNA-Seq library kit (NEB, Ipswich, MA) according to manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... The mutants DSR2 (N133A) and DSR2 (H171A) were constructed using the Q5 Site-directed Mutagenesis kit (NEB, E0554S) using eaither primers JG216 and JG217 ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by library preparation with NEBNext Ultra™ Directional RNA Library Prep Kit for Illumina (New England Biolabs). Sequencing was performed as 100 bp single read sequencing on HiSeq2500™ (Illumina).
-
bioRxiv - Microbiology 2021Quote: ... and domain-swapped chimeras were generated with the NEBuilder® HiFi DNA Assembly Cloning Kit (New England BioLabs). All toxins and chimeras were expressed and purified with cleavable N-terminal 6His-SUMO fusions (ThermoFisher) ...
-
bioRxiv - Microbiology 2021Quote: Plasmids were linearised by restriction digest and purified using Monarch PCR and DNA Clean-up Kit (NEB, USA). 3’UTRs were in vitro transcribed from 1μg of linearised plasmids using MEGAscript T7 Transcription Kit (Invitrogen ...
-
bioRxiv - Genomics 2021Quote: ... and sequencing libraries were prepared using the NEBNext Ultra DNA Library Prep Kit for Illumina (New England Biolabs). Single-end sequencing (75 bp ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA transcripts were expressed using the NEB HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs, Australia).
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR on extracted RNA was performed using the Luna One-Step RT-qPCR Kit (New England Biolabs). The samples were analyzed using a Lightcycler 480 instrument (Roche ...
-
bioRxiv - Bioengineering 2019Quote: ... Japan) were inserted downstream of SaCas9 into the vector using a NEBuilder HiFi assembly kit (New England Biolabs). For construction of plasmid used for cell sorting ...
-
bioRxiv - Microbiology 2021Quote: ... Treated RNA was used for cDNA library preparation by NEBNext Ultra II RNA library kit for Illumina (NEB).
-
bioRxiv - Molecular Biology 2020Quote: ... Exchange of V5/His to myc/His was performed using the Q5 site-directed mutagenesis kit (NEB #E0554) according to the manufacturer’s protocol resulting in pEF1-ZAP-S-myc/His and pEF1-ZAP-L-myc/His ...
-
bioRxiv - Microbiology 2019Quote: ... Table S2) were created by site-directed mutagenesis using the Q5 site-directed mutagenesis kit (New England BioLabs). For -10 region mutations ...
-
bioRxiv - Microbiology 2020Quote: ... Site-directed mutagenesis or promoter deletions were performed with the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). PCR reactions were done in 50 μL containing 25 μL of Q5 Hot Start High-Fidelity 2X Master Mix ...
-
A Bidirectional Switch in the Shank3 Phosphorylation State Biases Synapses toward Up or Down ScalingbioRxiv - Neuroscience 2021Quote: ... Constructs expressing GFP-tagged or HA-tagged Shank3 phospho-mutants were generated using the Gibson Assembly kit (NEB) with the wild-type Shank3 as the template ...
-
bioRxiv - Cancer Biology 2020Quote: ... Total RNA libraries were prepared by removing the ribosomal RNA with NEBNext rRNA depletion kit (New England Biolabs) and NEBNext Ultra II Directional RNA Library Prep kit for Illumina (New England Biolabs) ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA sequencing libraries were generated using the NEBNext Ultra RNA Library Prep Kit for Illumina (NEB England BioLabs). Fragmented and randomly primed 2 × 150□bp paired-end libraries were sequenced using Illumina HiSeq X10.
-
bioRxiv - Biophysics 2020Quote: ... Further truncation and point mutants of CreCat construct were prepared using the Q5 Site-Directed Mutagenesis Kit (NEB). Protein expression from E ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA libraries were prepared using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England BioLabs) with following changes to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: Final libraries were prepared on beads using the NEB-Next Ultra II DNA Library Prep Kit (NEB, #E7645) as follows ...
-
bioRxiv - Biochemistry 2022Quote: ChIP-seq libraries were prepared using NEBNext Ultra II DNA library prep kit for Illumina (New England Biolabs) and NEBNext Multiplex Oligos for Illumina (New England Biolabs ...
-
bioRxiv - Developmental Biology 2022Quote: ... Stranded cDNA libraries were generated using NEBNext Ultra Direction RNA Library Prep Kit for Illumina (New England Biolabs) and indexed with NEBNext Multiplex Oligos for Illumina (Dual Index Primer Set I ...
-
An alternatively spliced TREM2 isoform lacking the ligand binding domain is expressed in human brainbioRxiv - Molecular Biology 2022Quote: ... Bands were extracted for subsequent amplification as above and purification using a Monarch PCR Cleanup Kit (NEB T1030L). Purified products were sequenced commercially (ACGT ...
-
bioRxiv - Neuroscience 2022Quote: ... The RNA-seq libraries were prepared using either the NEBNext Ultra II Directional RNA Library Prep Kit (NEB) and sequenced with the Novaseq 6000 platform (ILLUMINA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Poly A selection was performed using NEB Next® Ultra ™ RNA Library Prep Kit (New England Biolabs) and the sequencing libraries (250∼300 bp insert cDNA library ...
-
bioRxiv - Biophysics 2022Quote: ... PCR cleanup was carried out on each amplicon sample using the Monarch PCR cleanup kit (New England Biolabs). The amplicons were then dual-indexed for paired-end read Illumina sequencing using Nextera primers N701 and N702 for the PEL and SUP of the 5.5 h time point and N705 and N706 for the PEL and SUP of the 9.0 h time point ...
-
bioRxiv - Plant Biology 2022Quote: ... DNA was subsequently extracted from T0 plants using Monarch DNA extraction kits (New England Biolabs, Ipswich, MA, USA) and sequence confirmed (CHU de Québec-Université Laval ...
-
bioRxiv - Genomics 2022Quote: ... ChIP libraries were prepared using NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB) and NEBNext® Multiplex Oligos for Illumina® (Index Primers Set 1 ...
-
bioRxiv - Genomics 2022Quote: ... Quality of the library was analyzed by Bioanalyzer and NEBNext® Library Quant Kit for Illumina® (NEB). IS libraries were sent for sequencing to c.ATG sequencing core facility at Tübingen University and sequenced on a MiSeq instrument 2×150 bp.
-
bioRxiv - Microbiology 2022Quote: ... The online NEBasechanger (https://nebasechanger.neb.com/) was used to design primers and the Q5 Site Directed Mutagenesis Kit (NEB) was used to generate pUPRTKO-ISC6pro-AC9ΔCC-3xTy (primers P13-14) ...
-
bioRxiv - Microbiology 2022Quote: ... Any host RNA and bacterial ribosomal RNA were depleted using the NEBNext rRNA Depletion Kits (New England BioLabs). Isolated RNA was then assessed for quality using the Agilent TapeStation system ...