Labshake search
Citations for New England Biolabs :
651 - 700 of 10000+ citations for Rat Heat Shock Protein Beta 8 HSPB8 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2024Quote: ... Nuclear proteins were extracted using nuclear extraction buffer (NEB) (20mM HEPES pH7.9 ...
-
bioRxiv - Biophysics 2024Quote: ... The sample was phosphorylated using protein kinase A (NEB) and then further purified on size exclusion chromatography.
-
bioRxiv - Molecular Biology 2024Quote: ... 300 pmol of Cas9 protein (NEB, Cat. No. M0386M) and 600 pmol of sgRNA were incubated in Cas9 Buffer (150 mM KCl ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Protein expression plasmids were cloned using Gibson Assembly (NEB Gibson Assembly Master Mix ...
-
bioRxiv - Genomics 2019Quote: ... and then cloned into a customized minigene plasmid (a derivative of the pSpliceExpress vector)29 containing an RSV-promoter and two control exons (rat insulin exons 2 and 3) using the NEBuilder® HiFi DNA assembly (NEB, E2621). Amplified fragments were inserted between the two control exons ...
-
bioRxiv - Genetics 2021Quote: ... including 8 bp barcode and P5 overhang (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCATCTTTGTGGAAAGGACGAAA CACCG-3’) using the Q5 Hot Start High-Fidelity polymerase (NEB #M0494S) for 22-24 cycles ...
-
bioRxiv - Evolutionary Biology 2021Quote: Reverse transcription was performed by adding the following to the above reaction: 8 uL of 5x first strand buffer (NEB E7330L), 2 uL of 10mM dNTPs (each) ...
-
bioRxiv - Molecular Biology 2021Quote: ... was resuspended in 10x NEB CutSmart Buffer (8:1) and dephosphorylated by incubation with Quick calf intestinal phosphatase (CIP) (NEB, # M0525S) at 37 °C for 20 min ...
-
bioRxiv - Biochemistry 2020Quote: ... and 8 pmol of purified DNA was then used for in vitro transcription with T7 RNA polymerase (New England Biolabs Inc.). The resulting RNA was purified with Agencourt RNAClean XP beads supplemented with an additional 12% of PEG-8000 (3 volumes of 40% PEG-8000 was added to 7 volumes Agencourt RNAClean XP beads ...
-
bioRxiv - Synthetic Biology 2019Quote: Fly genomic DNA was isolated in a pool by grinding in 25 µl of “Squish Buffer” (10 mM Tris, 1 mM EDTA, 25 mM NaCl, 8 U/ml ProK (NEB P8107S)) per adult ...
-
bioRxiv - Biochemistry 2021Quote: ... libraries were generated using 5 μl of the purified RT reaction product and 4-8 cycles of PCR with Q5 high fidelity polymerase (NEB, M0491S). PCR reaction products were column purified ...
-
bioRxiv - Microbiology 2020Quote: ... After adding 10% 1M sodium dodecyl sulphate (SDS) and 10 μL of 8 U/mL proteinase K (NEB, #P8107S, Ipswich, MA), the suspension was then incubated at 56°C for 4 hours ...
-
bioRxiv - Cancer Biology 2022Quote: ... for 5 min and then samples were incubated with ligation buffer (8 μl of 5x ligation stock (New England Biolabs, USA), 1 μl ligase and 31 μl of ultrapure water on each coverslip ...
-
bioRxiv - Microbiology 2020Quote: ... The flies were homogenised in 100 μl of TE-buffer pH 8 containing 1% Triton X-100 and 1% Proteinase K (NEB, P8107S). Homogenates were incubated for 3 h at 55°C followed by a 10 min incubation step at 95°C ...
-
bioRxiv - Microbiology 2021Quote: ... Then the product was incubated with 8 pmol of adapter and 3000 units T4 DNA ligase (MGI, 1000004279) in 80 μL of 1X PNK buffer (NEB, B0201S) with extra 1 mM ATP and 7.5% PEG-8000 at room temperature for 1 hour ...
-
bioRxiv - Cancer Biology 2023Quote: ... The end-repaired DNA was ligated with 5 μl Adapter Mix (ONT, SQK-LSK110) using 8 μl NEBNext Quick T4 DNA ligase (NEB, E6056) at 21°C for up to 1h ...
-
bioRxiv - Biochemistry 2024Quote: ... in vitro transcription templates were prepared via 8 cycles of PCR using 2x Q5 Master Mix (New England Biolabs, Cat. M0492S) with a T7 promoter containing forward primer as previously described ...
-
bioRxiv - Genetics 2023Quote: ... oligonucleotide pools were amplified by 8 to 10 cycles of PCR using NEBNext Ultra II Q5 Master Mix (New England Biolabs, M0544X), digested with BstXI and BlpI ...
-
bioRxiv - Genomics 2023Quote: ... DNA fragments were further size-selected by agarose gel elution and PCR amplified for 6 to 8 cycles using Illumina P1 and Index primer pair and Phusion® High-Fidelity PCR Master Mix (New England Biolabs). The final library was purified using Agencourt AMPure XP beads and quality assessed by Agilent Bioanalyzer 2100 (DNA 7500 kit ...
-
bioRxiv - Biophysics 2023Quote: ... on whose product we generate sticky ends and remove remaining pUC19 templates by a triple digest in 1X Cutsmart buffer with 8 μl SacI-HF (NEB, R3156S), 8 μl XhoI (NEB ...
-
bioRxiv - Developmental Biology 2023Quote: ... Eluted fragments were amplified by PCR with an appropriate number of PCR-cycles (5-8) using Custom NExtera PCR primers50 and the NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs, M0541S). Amplified DNA was purified using Qiagen MinElute Kit (Qiagen ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 0.8 μL of this was then used to template an 8 μL PCR using LongAmp® Hot Start Taq 2X Master Mix (M0533, NEB) with each amplification containing a unique combination of forward and reverse sequencing-barcoded primers that were cherry-picked into PCR reactions using Echo 525 with a 384PP plate as was done in the construction ...
-
bioRxiv - Molecular Biology 2024Quote: ... The adaptor-ligated DNA on the magnetic beads was amplified by 5-8 cycles of PCR using NEBNext Ultra II Q5 Master Mix (New England Biolabs, M0544) and NEBNext Multiplex Oligos for Illumina (New England Biolabs) ...
-
bioRxiv - Cell Biology 2022Quote: ... and protein samples and molecular weight markers (PageRuler Plus Pre-stained Protein Ladder, ThermoFisher Scientific 26619, or Colour pre-stained protein standards NEB P7712 or P7719) were separated using 8% ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 % SDS-PAGE gel was prepared and 50 μg of protein lysate was loaded along with the protein standard ladder (Cat.No.: P7719S, New England Biolabs, Ipswich, Massachusetts, United States), and electrophoresis was performed for 1.5 hr in ice-cold 1x Laemmli electrophoresis running buffer ...
-
bioRxiv - Biophysics 2021Quote: ... The E1371Q samples were phosphorylated using protein kinase A (NEB). The wild-type sample was de-phosphorylated using λ-phosphatase ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 µl 10x buffer for Protein MetalloPhosphatases (New England Biolabs), and 5 µl 10 mM MnCl2 for 30 min at 30 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Proteins associated to chromatin (pellet) were treated with DNaseI (NEB). Finally ...
-
bioRxiv - Molecular Biology 2020Quote: ... both proteins were deglycosylated by PNGase F (NEB, 1:50) overnight at 37°C in PBS ...
-
bioRxiv - Molecular Biology 2020Quote: ... A slurry of protein A or G magnetic beads (NEB) was used to capture enriched chromatin ...
-
bioRxiv - Molecular Biology 2021Quote: ... Proteins were digested using 4µl Proteinase K (800U/ml, NEB) and incubation at 55°C for 2h ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... The protein was digested with PNGase F (New England BioLabs) under denaturating conditions ...
-
bioRxiv - Cell Biology 2019Quote: ... The protein was purified on amylose resin beads (E8021S, NEB) according to manufacturer instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... Fusion proteins were purified in batch by amylose affinity (NEB), eluting in buffer B (buffer A with 0.02% DDM ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein/lysate sample de-N-glycosylation using PNGase F (NEB), Endo S (NEB) ...
-
bioRxiv - Biochemistry 2021Quote: ... Eluted protein samples flowed through Amylose resin (New England Biolabs) for a second step of affinity purification ...
-
bioRxiv - Neuroscience 2020Quote: ... Ca2+/calmodulin-dependent protein kinase II (CaMKII, New England Biolabs).
-
bioRxiv - Cell Biology 2020Quote: ... Blue Protein Standard Broad Range (New England Biolabs, Hitchin, UK) was used as a protein marker ...
-
bioRxiv - Cell Biology 2020Quote: ... 75 µl of protein G magnetic bead suspension (S1430, NEB) pre-equilibrated in lysis buffer was added to each tube and incubation continued for additional 1 h at +4□C ...
-
bioRxiv - Biophysics 2022Quote: ... Fusion proteins were purified in batch by amylose affinity (NEB), eluting in buffer B (buffer A with 0.02% DDM ...
-
bioRxiv - Cancer Biology 2022Quote: ... purified GST-fusion proteins were incubated with CK2 enzyme (NEB) in 20μl kinase buffer (20mM Tris-HCI [pH 7.5] ...
-
bioRxiv - Molecular Biology 2022Quote: ... recombinant kinases (2500 U/mg protein for PKA (NEB-P600S), 500:1 Tau:kinase for Gsk3ß (BPS-40007) ...
-
bioRxiv - Molecular Biology 2022Quote: ... O-glycosidase (New England Biolabs, 20 000 U/μg protein), α2-3,6,8 neuraminidase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2022Quote: ... α2-3,6,8 neuraminidase (New England Biolabs, 25 U/μg protein) and α-N-acetyl-galactosaminidase (New England Biolabs ...
-
bioRxiv - Neuroscience 2022Quote: ... and 1x NEB-uffer for Protein Kinases (New England Biolabs). The samples were then subjected to protein precipitation ...
-
bioRxiv - Cell Biology 2022Quote: ... purified recombinant PKA proteins (2,500 units/ml, New England Biolabs) along with 100 μM cAMP ...
-
bioRxiv - Biochemistry 2021Quote: 10 ug of protein extract were digested with PNGaseF (NEB) according to manufacturer instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... 1X protease inhibitor cocktail ± lambda protein phosphatase (New England Biolabs) as per the manufacturer’s instructions and incubated at 30°C for one hour.
-
bioRxiv - Cell Biology 2022Quote: ... samples were treated with Lambda Protein Phosphatase (New England BioLabs). We found that for efficient dephosphorylation of CSF extract samples ...
-
bioRxiv - Developmental Biology 2022Quote: ... The Cas9nls protein was obtained from NEB (cat number M0646T).