Labshake search
Citations for New England Biolabs :
651 - 700 of 4230 citations for R 4 5 Isopropylidene 2 pentanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: ... and 2 U/mL YIPP (NEB).50 Af tRNA nucleotidyl transferase was purified with the same method and buffers as the MBP-MS2 fusion protein.38 The reaction was incubated at 37 °C for 2 hours ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 U M.CviPI (NEB, Cat# M0227S), 160 μM S-adenosylmethionine (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 µl of 10X buffer (NEB), and 833 µM of cytidine 3’-phosphate at 37° C for 1 hour ...
-
Promoter-adjacent DNA hypermethylation can downmodulate gene expression: TBX15 in the muscle lineagebioRxiv - Molecular Biology 2022Quote: ... pCMV-CLuc 2 (New England Biolabs) encoding the Cypridina luciferase was co-transfected with the test construct ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2µl 10× GlycoBuffer 2 (NEB) buffer at 37°C 1h ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µl 10% NP-40 (NEB) and 2µl 10× GlycoBuffer 2 (NEB ...
-
bioRxiv - Genetics 2024Quote: ... 2 µl Cas9 Protein (M0386, NEB), 0.5µl buffer (NEB) ...
-
bioRxiv - Genomics 2024Quote: ... 0.5 µL 10x NEBuffer 2 (NEB), 0.8 µL 8-HQ (500 µM ...
-
bioRxiv - Genomics 2024Quote: ... 0.5 µL 10x NEBuffer 2 (NEB), 1.3 µL water and 0.2 µL Therminator IX (NEB ...
-
bioRxiv - Immunology 2024Quote: ... 2 × RNA loading dye (NEB, #B0363S) were added to the system to stop the reaction and the RNA was separated by agarose gel electrophoresis.
-
bioRxiv - Molecular Biology 2024Quote: ... + 2 μL BlpI (NEB cat# R0585S) + nuclease-free water to 50 μL ...
-
bioRxiv - Microbiology 2024Quote: ... 2 U of quick CIP (NEB), and water as needed ...
-
bioRxiv - Molecular Biology 2024Quote: ... T4 RNA ligase 2 (M0239S, NEB), Leupeptin (PI78435 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... (2) 1 µL of DpnI (NEB) was added and incubated at 37°C for two hours ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 mM Vanadyl ribonucleoside complex (NEB), 2X SSC ...
-
bioRxiv - Genomics 2024Quote: 2 μL USER enzyme (NEB #M5505) was added to each PCR amplification reaction containing deaminated DNA library ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 2 mM VRCs (NEB # S1402S) were added ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 µL 10 mM dNTPs (NEB), and 1 µL DNA Polymerase I ...
-
bioRxiv - Genetics 2020Quote: ... and 4 μl of DNA polymerase I Klenow (NEB), and incubating at 37 °C for 1 hour with rotation ...
-
bioRxiv - Microbiology 2021Quote: ... 9 Neuraminidase A (P0722, NEB, 4 units/µg protein). 10 µg glycoprotein ...
-
bioRxiv - Microbiology 2020Quote: ... and 4 μL T4 polynucleotide kinase (New England BioLabs) in a 100 μL reaction for 2 hours and purified using P-30 spin columns (BioRad) ...
-
bioRxiv - Cell Biology 2021Quote: ... and 4 U/µl Taq DNA ligase (M0208S, NEB)).
-
bioRxiv - Molecular Biology 2022Quote: ... including 2.5-4 min fragmentation at 94⁰C (NEB).
-
bioRxiv - Microbiology 2021Quote: ... Index Primers Sets 3 and 4 (New England Biolabs). Libraries were sequenced on an Ilumina NextSeq500 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... were mixed with 4 uL T4 buffer (NEB B0202S), 4 uL BbsI-HF (NEB R3539L ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 4 µL of 5x Phusion HF Buffer (NEB #B0518), and 1.6 µL of 2.5 mM dNTPs (NEB #N0447) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 4 µL of 5x Phusion HF Buffer (NEB #B0518S), and 0.4 µL of 10 mM dNTPs ...
-
bioRxiv - Microbiology 2023Quote: ... transcripts were treated with 4 U DNase I (NEB) for 30 min at 37°C and subsequently separated on urea-polyacrylamide (PAA ...
-
bioRxiv - Cell Biology 2023Quote: ... or 4 μL of α2-3,6,8,9 Neuraminidase A (NEB) in 1x NEB Glyco Buffer #1 (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... micrococcal nuclease (MNase; 4×105 units; New England Biolabs) or RNase A (2 µg ...
-
bioRxiv - Biochemistry 2024Quote: ... 4 μL of t7 polymerase (New England Biolabs #M0251S), 33 μL RNase-Free water ...
-
bioRxiv - Biochemistry 2024Quote: ... and 4 units of Proteinase K (New England Biolabs).
-
bioRxiv - Microbiology 2023Quote: ... 4 μl of murine RNase inhibitor (New England Biolabs), and 40 μg (HEK293T and U2OS cells ...
-
bioRxiv - Genomics 2022Quote: ... 4 U of T7 DNA polymerase (New England Biolabs) were used to perform second-strand synthesis and DNA was purified using CleanPCR beads ...
-
bioRxiv - Microbiology 2022Quote: ... 4 μL of 10X RNase H buffer (NEB B0297S) and incubating for 30 minutes at 37°C ...
-
bioRxiv - Genomics 2024Quote: ... and 4 μl of Klenow DNA polymerase (NEB M0210L) to the mixture ...
-
bioRxiv - Molecular Biology 2024Quote: ... or 4 µL of α2-3,6,8,9 Neuraminidase A (NEB,) in 1x NEB Glyco Buffer #1 (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... incubated with 4 units of Dam enzyme (NEB, M0222L). We use Damonly control samples to normalize for DNA accessibility and amplification biases as described (Vogel et al ...
-
bioRxiv - Genomics 2024Quote: ... incubated with 4 units of Dam enzyme (NEB, M0222L). We use Dam-only control samples to normalize for DNA accessibility and amplification biases as described (77) ...
-
bioRxiv - Genetics 2023Quote: ... The T7 promoter and mtdTomato CDS were amplified from pmrPTRE-AAV using PTRE_floxed_F/R and Phusion High-Fidelity PCR Master Mix (NEB). NotI and SalI sites added by the primers were used to subclone this amplicon into pRM1506_TMM432 ...
-
bioRxiv - Cell Biology 2020Quote: ... Renilla luciferase was PCR amplified from pMT-DEST48-FLP 31 with Renilla Luciferase Forward: 5’-TGGAAGCTTGGCATTCCGGTACTGTTGGTAAAGCCACCATGACTTCGAAAGTTTATG-3’ and Renilla Luciferase Reverse: 5’-TGGAAGCTTTTATTATTGTTCATTTTTGAGAAC-3’ and digested with HindIII (NEB). Renilla luciferase was then ligated into pGL3-Control digested HindIII (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... The purified cDNA was then ligated with 5’ adapter (5’/5Phos/AGATCGGAAGAGCGTCGTGTAGCTCTTCCGATCTN10/3SpC3/-3’ with 1:20 molar ratio of RNA to 5’adapter) using Quick Ligation Kit (NEB) at 37°C overnight ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ adapter (RNA oligo: 5’P-GAUCGUCGGACUGUAGAACUCUGAAC-3’InvdT) was pre-adenylated prior to use (5’ DNA adenylation kit, NEB, according to the manufacturer’s instructions) ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA fragments were end-repaired and T-tailed with Klenow fragment lacking 5’ → 3’ and 3’ → 5’ exonuclease activity (NEB). In-house adapters containing 8-nucleotide unique molecular identifier (UMI ...
-
bioRxiv - Systems Biology 2021Quote: ... 1 µL of the boiled colony was used for PCR with primer pair (JGI_27F: 5’-AGAGTTTGATCCTGGCTCAG-3’and JGI_1391R: 5’-GACGGGCRGTGWGTRCA-3’) with NEB Q5 Polymerase (New England Biolabs, Ipswitch, MA). The PCR amplicon was confirmed by agarose gel electrophoresis and the sequence was determined using conventional Sanger Sequencing (Genewiz LLC ...
-
bioRxiv - Biochemistry 2021Quote: ... The reaction was stopped by incubating at 65°C for 5 min followed by addition of 5 mM MgCl2 and 0.5 units of Shrimp Alkaline Phosphatase (rSAP, NEB M0371S). The phosphatase reaction was incubated at 37°C for 15 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... RJ-167-mer and RJ-5’Tail-167mer were radiolabeled with 32P at the 5′-end using T4 Polynucleotide Kinase (NEB). To generate the 3′ Tail and dsDNA DNA substrates ...
-
bioRxiv - Cell Biology 2022Quote: ... The 229E Spike cDNA was amplified by PCR with the forward primer: 5’-TTTTTTGCGGCTAGCATGTTCGTGCTGCTGG and the reverse primer: 5’-TTTTTTGCGCTCGAGTCACGCCGGCGCCACCTGGCTGGTTTCGGTCTGGATGTGGATC TTTTCCA using Phusion polymerase (New England Biolabs) according to manufacturer’s instruction ...
-
bioRxiv - Microbiology 2021Quote: ... forward and reverse primer for GFP (forward 5’TCGACAGTCAGCCGCATCT3’ and reverse primer 5’CCGTTGACTCCGACCTTCA3’) respectively using 1μl taq polymerase (NEB, USA). The PCR amplification was performed as per the following cycle ...
-
bioRxiv - Neuroscience 2022Quote: ... and oligos annealed with adapters to the sense 5’ - CACC and antisense 5’-AAAC were ligated using Quick Ligase Kit (New England Biolabs). Ligated product was transformed into stabl3 competent E ...