Labshake search
Citations for New England Biolabs :
651 - 700 of 3658 citations for Diethyl 2 5 diaminoterephthalate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... 2 μL of rCutSmart Buffer (NEB, B6004S), 1 μL of PaqCI/AarI activator (5 pmol ...
-
bioRxiv - Genetics 2023Quote: ... 2 µl of T4 DNA ligase (NEB), and 9 µl nuclease-free water were mixed and incubated at 22°C for 2 hours ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 mM ribonucleoside vanadyl complex (NEB, S1402S), 100 units/mL SUPERaseIn (Thermo Fisher ...
-
bioRxiv - Cell Biology 2024Quote: ... + 2 mM vanadyl-ribonucleoside complex (NEB S1402) + 0.02% [w/v] BSA ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 μl T4 PNK (NEB, #M0201L) to the dephosphorylated nuclei sample and incubate at 37°C for 15 min ...
-
bioRxiv - Genetics 2024Quote: ... 2 mM Vanadyl Ribonucleoside complex (NEB S142), 0.5% BSA (Ambion ...
-
bioRxiv - Genomics 2024Quote: ... 2 μl of Antarctic Phosphatase Enzyme (NEB), and 2 μl of water ...
-
bioRxiv - Genomics 2023Quote: ... 2 μL 10×ThermoPol Reaction Buffer (NEB), 0.5 μL 10 mM dNTP mix ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2 mM VRC (New England Biolabs).
-
bioRxiv - Cell Biology 2023Quote: Recombinant human Casein Kinase 2 (NEB, P6010S) and Protein Kinase A (NEB ...
-
bioRxiv - Biophysics 2023Quote: ... in NEBuffer 2 (New England Biolabs #B6002) at 37°C for 30 minutes followed by column purification ...
-
bioRxiv - Genomics 2023Quote: ... and 2 mM VRC (New England Biolabs) for 7 min on ice and stored in 70% ethanol ...
-
bioRxiv - Genomics 2022Quote: ... 10 μl of 2% BSA (NEB B9000S), 2 μl of 20 U/mL SUPERaseIn ...
-
bioRxiv - Synthetic Biology 2023Quote: ... rabbit anti-Sox-2 (New England Biolabs), and rabbit anti-NANOG (New England Biolabs) ...
-
bioRxiv - Bioengineering 2024Quote: ... rabbit anti-Sox-2 (New England Biolabs), and rabbit anti-NANOG (New England Biolabs) ...
-
bioRxiv - Systems Biology 2024Quote: ... 2 μL of T4 DNA ligase (NEB) were added and incubated at RT for 30 min ...
-
bioRxiv - Microbiology 2024Quote: ... 2 μL of Murine RNase Inhibitor (NEB) and 5 μL of Baseline-ZERO DNase were added to each sample ...
-
bioRxiv - Immunology 2024Quote: ... and 2 µL of Proteinase K (NEB)) ...
-
bioRxiv - Genomics 2024Quote: ... and 2 µL 10x NEBuffer 3 (NEB) in a total volume of 20 µL and was incubated for 40 min at 37 °C and 60 min at 45 °C ...
-
bioRxiv - Genomics 2024Quote: ... and 2 µL 10x ThermoPol Buffer (NEB) in a total volume of 20 µL and was incubated for 30 min or overnight at 37°C ...
-
bioRxiv - Genomics 2024Quote: ... and 3 µL 10x NEBuffer 2 (NEB) were added for a final volume of 30 µL ...
-
bioRxiv - Genomics 2024Quote: ... 2 µL (40 U) Exo I (NEB) was added ...
-
bioRxiv - Genomics 2024Quote: ... 2 U/µL Phusion polymerase (NEB #M0530S), 10% formamide ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 µL 100 mM dNTPs (NEB) and heated at 65° C for 5 minutes ...
-
bioRxiv - Developmental Biology 2024Quote: ... containing 2 pg of lambda-DNA (NEB, N3011S ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μl 10% NP-40 (NEB, B2704S), 5 μl H2O and 1 μl PNGase F (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was PCR amplified using primers: 5’-gaagaaatgaatttgccagg-3’ and 5’-ctcatgttcttcttgggc-3’ and Phusion DNA Polymerase Master mix (New England Biolabs, Ipswich, MA). DNA was sent for Sanger Sequencing to check for reversion mutations.
-
bioRxiv - Immunology 2022Quote: ... To generate a truncated version of Siglec-5 (pME- tSiglec-5) the ITIM and ITSM were excised from the pME-Siglec 5 plasmid with the restriction enzymes BbsI/MfeI (NEB, Ipswich, MA) and blunt ends were generated with DNA Polymerase I ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using 5 units of MseI enzyme per 1 μg of DNA and 5 μl of 1X SmartCut™ Buffer (New England Biolabs®). This was followed by the incubation for 45 min at 37°C and inactivation for 20 min at 65° C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μl of the gRNA mixture was mixed with Cas9-NLS protein (final concentration of 5 μM. New England Biolabs, Ipswich, USA), 2M KCl (final concentration of 300mM) ...
-
bioRxiv - Genetics 2023Quote: The yeast plasmids recovered after thermoselection were subject to a shortened PCR with 15 cycles with oligonucleotide pairs oWS1408 (5°-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCAGCATATAATCCCTGCTTTA-3°) and oWS1409 (5°-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTCCAGGGGTGGTGCAAACTATG-3°) using a high-fidelity Q5 polymerase (New England Biolabs, Ipswich, MA) to attach overhang sequences ...
-
bioRxiv - Plant Biology 2022Quote: The pVecBar-Rht13 construct contained a 6,998 bp fragment including 2,532 bp upstream and 450 bp downstream regions amplified from Magnif mutant genomic DNA using primers Rht13-NotF2 (5’ AATGCGGCCGCAATCGATAGGAGAGCTGCGTCTGTGTG 3’) and Rht13-AscR2 (5’ TGCGTACGGCGCGCCGAGAGTCGCCTTGCCAGTTC 3’) with Phusion® High-Fidelity DNA Polymerase (NEB, USA). pVecBarIII is a derivative of pWBvec8 (Wang et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... The G4 sequence and larger 5′ UTR (three human β-globin 5′ UTR sequences in tandem) were inserted using the Q5 Site-Directed Mutagenesis Kit (NEB # E0552S). pcDNA3.1(+)/mEGFP was a kind gift from Jeremy Wilusz (Baylor College of Medicine) ...
-
bioRxiv - Genetics 2023Quote: ... 10 µg of the K3L variant library was digested with 5 µL of BstEII-HF and 5 µL SacI-HF (NEB Cat#R3156S) in a 50 µL reaction to generate a linear insert fragment of approximately 1130bp ...
-
bioRxiv - Biophysics 2024Quote: ... First the 5’ triphosphate of RNA was converted into a 5’ monophosphate by incubating 100 µg RNA with 100 units of RNA 5’ Pyrophosphohydrolase (NEB, Ipswich MA) at 37°C for 1 hour within a 100 µl reaction volume ...
-
bioRxiv - Biochemistry 2023Quote: ... and “frq segment 4F” (5’-CACCGATCTTTCAGGAGACCCTG-3’) and “frq segment 4R” (5’-CACTCAGGTC TCAATGGTGA TG-3’) pair with pCB05 digested with FseI (NEB, Catalog # R0588S) and MluI (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... “frq segment 3F” (5’-GTCGCACTGGTAACAACACCTC-3’) and “frq segment 3R” (5’-CAGCACATGTTCAACTTCATCAC-3’) were designed for pCB05 digested with NruI (NEB, Catalog # R0192S) and FseI (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... The library was amplified in triplicate PCR reactions using oligonucleotides corresponding to the Illumina sequence adaptors (5’-AATGATACGGCGACCACCGAGATCTACAC-3’ and 5’-CAAGCAGAAGACGGCATACGAGAT-3’) and Phusion DNA polymerase (New England Biolabs, cat. M0531) for 11 cycles ...
-
bioRxiv - Microbiology 2024Quote: ... The variable region V3+V4 of the 16S rRNA gene was amplified using a broad-range primer pair (338F: 5’-ACTCCTACGGGAGGCAGCA-3′, 806R:5′-GGACTACHVGGGTWTCTAAT-3′) using the Phusionâ High-Fidelity PCR Master Mix (New England Biolabs, Beverley, MA). The PCR amplification program was as follows ...
-
bioRxiv - Synthetic Biology 2024Quote: ... was generated from Venus BBa_J176006 with primers 5’-tctgcacctgaggccaccatggtgagcaagggcgagg and 5’-ggtcacgaattccagcaggaccatgtgatcg via high fidelity PCR followed by spin-column purification (NEB #E0555, Sigma #NA1020). The YFP fragment and mutated pSBtet-GP plasmid were double-digested with Eco81I/ EcoRI (Thermo #FD0374 ...
-
bioRxiv - Biophysics 2024Quote: ... The PDZ and Protease domain of HtrA1 were amplified using primers 5’-ATCACCAAGAAGAAGTATATTG-3’ and 5’-GGATCCTTTTTCGAACTGC-3’ as well as 5’-TAGCTCGAGCACCACCAC-3’ and 5’-TTTGGCCTGTCGGTCATG-3’with a NEB Q5® Site-Directed Mutagenesis Kit (New England Biolabs, MA). The mutation of S328A of HtrA1 and its Protease domain were created using primers 5’-CTATGGAAACgcgGGAGGCCCGT-3’ and 5’-TTGATGATGGCGTCGGTCTG-3’ with a NEB Q5® Site-Directed Mutagenesis Kit (New England Biolabs ...
-
bioRxiv - Biophysics 2024Quote: ... The mutation of S328A of HtrA1 and its Protease domain were created using primers 5’-CTATGGAAACgcgGGAGGCCCGT-3’ and 5’-TTGATGATGGCGTCGGTCTG-3’ with a NEB Q5® Site-Directed Mutagenesis Kit (New England Biolabs, MA). The PCR protocol was as followed ...
-
bioRxiv - Genomics 2021Quote: ... 5’-deadenylase (Cat. No. M0331S; NEB; use 0.5 uL), PEG 8000 (final concentration = 10% (w/v)) ...
-
bioRxiv - Cell Biology 2020Quote: ... an oligonucleotide was 5’-labeled using PNK enzyme (NEB). The ITS2 probe was previously reported (Donati et al. ...
-
bioRxiv - Genomics 2021Quote: ... 5 U of Klenow Fragment (New England Biolabs, M0210) were added and incubated at 25°C for 20 minutes ...
-
bioRxiv - Genomics 2022Quote: ... 5 units (50 Gel Units) of Micrococcal Nuclease (NEB) were added to one tube and 20 units (200 Gel Units ...
-
bioRxiv - Molecular Biology 2020Quote: ... Un-reacted linkers were digested with 5’ deadenylase (NEB) and RecJ exonuclease (epicentre ...
-
bioRxiv - Genomics 2020Quote: ... 5′ end phosphorylation using T4 polynucleotide kinase (NEB, M0201L), (4 ...
-
bioRxiv - Molecular Biology 2020Quote: 5 μl Bst 3.0 (NEB, M0374L, 8,000 units/ml),
-
bioRxiv - Microbiology 2020Quote: ... 40 nmol ATP and 5 U RppH respectively (NEB). After each enzymatic treatment ...