Labshake search
Citations for New England Biolabs :
651 - 700 of 2908 citations for Calcium calmodulin Dependent 3' 5' Cyclic Nucleotide Phosphodiesterase 1C PDE1C Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: ... coli NEB 5-alpha (NEB) and plated onto medium with the cognate antibiotic ...
-
bioRxiv - Bioengineering 2019Quote: ... 5 U T4 ligase (NEB), and water for a total reaction volume of 20 μl ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 5’ dephosphorylation protocol (NEB #M0289) and T4 DNA ligase protocol (NEB #M0202) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μl HinFI (NEB, R0155S), 5 μl ExoI buffer (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.5μl 5’ Deadenylase (NEB M0331S), 1μl RecJ endonuclease (NEB M0264S) ...
-
bioRxiv - Molecular Biology 2021Quote: ... coli 5-alpha cells (NEB). Plasmid DNA from multiple independent clones was isolated for each construct using a Zymo Zyppy 96-well plasmid prep kit ...
-
bioRxiv - Biochemistry 2022Quote: ... 5 ng ET SSB (NEB), 4 nM phi29 DNAP in a 100 μl reaction and incubated for 3 h at 30°C ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 5 μL rCutSmart Buffer (NEB), and 1 μL DpnI (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 nL PEG8000 (50%, NEB) 0.5 nL BSA (20ng/ml ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 nL PEG8000 (50%, NEB), 1.2 nL BSA 20 ng/ml (NEB) ...
-
bioRxiv - Microbiology 2023Quote: ... coli 5-alpha cells (NEB) following manufacturer’s recommendations and selected by plating on LB in the presence of appropriate antibiotics ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µL RppH (NEB #M0356S). Decapped RNA was cleaned using Zymo Oligo clean and concentrator kit (Zymo Research #D0460 ...
-
bioRxiv - Microbiology 2023Quote: ... and 5’-deadenylase (NEB M0331S) treatments ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5’ deadenylase (NEB, M0331) for 30min at 30°C followed by column purification (Zymo research ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli NEB 5-alpha (NEB) was used for standard cloning of other plasmids ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 U BbsI (NEB, R0539L) and nuclease-free water for a total of 5 µl reaction mix ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli NEB 5-alpha (NEB) and otherwise followed the manufacturers recommended protocol ...
-
bioRxiv - Genetics 2023Quote: ... 5 units of HindIII (NEB), 4.13 µL of H2O ...
-
bioRxiv - Genetics 2023Quote: ... 5 units of HindIII (NEB), and 6.33 uL of purified DNA ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 U BsaI-HFv2 (NEB), 250 U T4 DNA ligase (2,000,000 U/ml ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-decapping (RppH, M0356S; NEB) and 5′-hydroxyl group repair (T4 polynucleotide kinase (M0201L ...
-
bioRxiv - Molecular Biology 2023Quote: ... NcoI- HF (NEB, 5 U) or Rad50/Mre11 (125 nM final tetramer ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3 µl Hind III (Fisher, FD0504), 3 µl EcoRI (Fisher, FD0274), and 3 µl Bam HI (Fisher, FD0054) in RNase H buffer (NEB, M0297) overnight at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... a 3′ RNA adapter with a phosphate on its 5’ (5’- /5Phos/r(N:25252525)r(N:25252525)r(N:25252525)rUrGrGrArArUrUrCrUrCrGrGrGrUrGrCrC rArArGrG/3SpC3/-3’) end was ligated to RNA 3’ ends using T4 RNA ligase 1 (NEB, M0437) at 25 °C for 75 min (with gentle agitation every 10 min) ...
-
bioRxiv - Cell Biology 2022Quote: 5’ Phosphorylated RA3 oligonucleotides were adenylated using 5’ DNA Adenylation Kit (New England BioLabs E2610S), by mixing 1 μL of 100 μM of 5’ Phosphorylated RA3 ...
-
bioRxiv - Microbiology 2020Quote: A template-switching 5’ rapid amplification of cDNA ends (5’-RACE) kit (New England BioLabs) was used to map the transcription start site of rflP ...
-
bioRxiv - Molecular Biology 2022Quote: ... Pre-adenylation was performed on 5 nmoles using the 5’ DNA Adenylation Kit (NEB, E2610L) as follows ...
-
bioRxiv - Molecular Biology 2022Quote: ... Unligated linkers were depleted by using 5 U per sample of 5’ deadenylase (NEB, #M0331S) and RecJ exonuclease (Biosearch Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... IRES mRNAs were capped with the A(5’)ppp(5’)G cap analog (NEB # S1406L). Post-transcriptional polyadenylation was performed using E ...
-
bioRxiv - Molecular Biology 2021Quote: ... The repair template was made by annealing oligos described in Supplementary File 3 and extending the 3’ ends using Phusion Polymerase (New England Biolabs, Beverly, MA). SIR3 overexpression strain and its control strain was created by transformation and maintenance of 2-micron plasmids pJR3526 and YEp24 ...
-
bioRxiv - Microbiology 2020Quote: ... and one fragment of about 320 bp of the 3’-terminal region by 3’ RACE were amplified using Phusion High-Fidelity PCR Kit (New England Biolabs, MA, USA) under the following conditions [98°C ...
-
bioRxiv - Neuroscience 2022Quote: ... the full-length msi1 or msi2 human cDNA and the msi-1 3’UTR were fused to a 3 kb fragment of the rig-3 promoter using NEBuilder Hifi DNA assembly (New England Biolabs, Ipswich, MA).
-
bioRxiv - Biophysics 2021Quote: ... Fragmented 5’-OH sites were phosphorylated by treatment with 5 units of T4 polynucleotide kinase (NEB) for 1 hour at 37 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... castellii genomic sequence in between the ORFs NCAS0D00680 and NCAS0D00690 was amplified (primers: Ncas_Int618_For 5′-GTTCGCCGGCCTTCCCGCGCTATGAAATTA and Ncas_Int618_Rev 5′-ATCAGGCGCCGAGCATAACCGCTCAAATGC) and inserted between the NaeI and KasI (NEB) restriction sites ...
-
bioRxiv - Molecular Biology 2022Quote: ... the DTB-GTP cap was removed leaving a 5’ monophosphate terminus using RNA 5’pyrophophohydrolase (NEB), RNA was bound to AMPure beads and eluted in low TE (10mM Tris pH8.0 ...
-
bioRxiv - Molecular Biology 2019Quote: ... castellii genomic sequence downstream of the ORF NCAS0C00690 was amplified (primers: Ncas_Int696_For: 5′-GGCCGGTACCAATTCATCTAGCAGGATGTAAAATG; Ncas_Int696_Rev: 5′-GAAAGCCGGCGTAGAGCATGCGAGGTTTGG) and inserted between the KpnI and NaeI (NEB) restriction sites in pRS404 (3) ...
-
bioRxiv - Molecular Biology 2019Quote: ... castellii genomic sequence upstream of the ORF NCAS0E03540 was amplified (primers: Ncas_Int701_For 5′-ATTCGGATCCTGCAGGCTGTTTGCTGTACT; Ncas_Int701_Rev 5′-GGTGGCGGCCGCGGGGTAACTATCCGCGTCTAA) and inserted between the BamHI and NotI (NEB) restriction sites in pRS402 (5) ...
-
bioRxiv - Immunology 2022Quote: ... Vκcons 5’GGCTGCAGSTTCAGTGGCAGTGGRTCWGGRAC3’ and Jκ5SHM 5’AGCGAATTCAACTTAGGAGACAAAAGAGAGAAC3’ using Phusion High-Fidelity DNA Polymerase (New Englands Biolabs) and according to following program ...
-
bioRxiv - Genetics 2024Quote: ... m7G(5’)ppp(5’)G RNA Cap Structure Analog (New England Biolabs, 4:1 to GTP) was supplemented to the in vitro transcription reaction ...
-
bioRxiv - Microbiology 2020Quote: ... followed by 3’ adaptor ligation using T4 ligase (NEB). The ligated products used for reverse transcription with SSIII (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... followed by 3′ adaptor ligation using T4 ligase (NEB). The ligated products were used for reverse transcription with SSIII (Invitrogen ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 µL murine RNase Inhibitors (40 U/µL NEB) and 125 µM NTP-mix (NEB) ...
-
bioRxiv - Biochemistry 2019Quote: ... and 3 protease inhibitor cocktail tablets (New England Biolabs) were added to the cell suspension ...
-
bioRxiv - Biochemistry 2020Quote: ... and 3 μL of CutSmart buffer (New England Biolabs) with 4 μL of sterile water ...
-
bioRxiv - Bioengineering 2021Quote: ... and 3 μl Klenow Fragment (exonuclease-deficient; M0212, NEB). The HDMI-array was incubated at 37 °C for 2 hr in a humidity-controlled chamber.
-
bioRxiv - Microbiology 2020Quote: ... 3’ blocked oligodeoxynucleotide RNA linker (S1315S, New England BioLabs) was ligated to the 3’ ends of RNAs by incubation with RNA ligase 2 ...
-
bioRxiv - Cell Biology 2021Quote: ... Then 3 µl USER® Enzyme (New England BioLabs) was used with size-selected ...
-
bioRxiv - Cell Biology 2021Quote: ... and 3 µl of G3 reaction buffer (NEB, MA) and 2 µl PNGase F (NEB P0704S) ...
-
bioRxiv - Microbiology 2020Quote: ... followed by 3’ adaptor ligation using T4 ligase (NEB). The ligated products used for reverse transcription with SSIII (Invitrogen ...
-
bioRxiv - Biochemistry 2022Quote: ... T4 PNK 3’ phosphatase minus (New England BioLabs, M0236S) was used.