Labshake search
Citations for New England Biolabs :
651 - 700 of 5842 citations for 7 Oxabicyclo 4.1.0 hepta 2 4 diene 1 3 4 trifluoro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA was extracted from homogenized cell lysate by 4 × 250 µL/brain Oligo (dT)25 magnetic beads (New England Biolabs, Cat: S1419S), and immunoprecipitated (IP ...
-
bioRxiv - Genomics 2023Quote: ... Illumina libraries for all 4 isolates were constructed using the NEBNext Ultra II FS DNA Library Prep Kit (New England Biolabs Inc., USA) as per standard protocol and sequenced using the Illumina MiSeq and NextSeq500 platforms (paired end ...
-
bioRxiv - Microbiology 2023Quote: ... followed by 12 cycles of 95°C for 15 seconds and 60°C for 4 min followed by exonuclease I (New England Biolabs, PN M0293S) treatment at 37°C for 30 minutes and 80°C for 15 minutes to remove any unincorporated primers ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was ligated for 4 h in a water bath at 16 °C (30 Weiss Units of T4 DNA Ligase, M0202 New England BioLabs® Inc). 300 μg of Proteinase K was used to reverse the cross-linking overnight at 65°C ...
-
bioRxiv - Microbiology 2024Quote: ... GM16 genomic DNA using primers SA-Reg FWD and SA-Reg REV (Table 4) and polymerase Q5 (New England Biolabs, Massachusetts, USA). The destination plasmid pGW44 [33] was linearized using primers pGW44 FWD and pGW44 REV ...
-
bioRxiv - Cell Biology 2021Quote: ... RHA PCR products were ligated into pAAV p21 vector by Gibson assembly at a ratio vector:inserts of 1:2:2 using T4 DNA ligase (NEB). All constructs were checked by sequencing before transfection into cells ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 μL of 2-Log DNA Ladder (200 μg/mL; NEB) is mixed with 1 μL of Gel Loading Dye (6x ...
-
bioRxiv - Genomics 2021Quote: ... 2 μL of 1 mg/ml bovine serum albumin solution (NEB), 1 μL of hOGG1 (ProSpec TechnoGene Ltd. ...
-
bioRxiv - Microbiology 2020Quote: ... 1–2 mg of RNA was treated with DNAse I (NEB), x µL and 2 µL of this reaction was used to make cDNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 ul of micrococcal nuclease (Biolabs M02475, 2×106 U/ml) was added to 200 μl buffer containing 1 mM CaCl2 and incubated for 10 min 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... 1× LongAmp® Taq 2× Master Mix (New England Biolabs, UK), and 2 μL of a unique barcode ...
-
bioRxiv - Biophysics 2023Quote: ... and 5 U Klenow in 1× NEBuffer 2 (New England BioLabs) (120 μL total volume ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1 μl T4 RNA ligase 2 truncated KQ (NEB M0373L). Plugs were then rinsed with 1 ml Tris buffer ...
-
bioRxiv - Molecular Biology 2019Quote: ... 100 pmol of the oligonucleotides 5’-ATTGTCATACCGATCCCAATTCGA-3’ and 5’-AAACTCGAATTGGGATCGGTATGAC-3’ were phosphorylated for 30 min at 37 °C using 1 mM ATP and 1 unit polynucleotide kinase (NEB) in the buffer supplied by the manufacturer and then hybridized in a thermocycler (5 min 95 °C ...
-
bioRxiv - Genomics 2021Quote: ... End fill-in and A-tailing were performed by addition of Klenow Fragment 3’ --> 5’ exo-(Enzymatics) and dNTP mix (10 mM dATP, 1 mM dCTP, 1 mM dGTP New England Biolabs). After ligation to methylated Illumina TruSeq LT v2 adaptors using T4 DNA Ligase rapid (Enzymatics) ...
-
bioRxiv - Biochemistry 2021Quote: ... were 3′ end-radiolabeled by incubation for 1 hr at 16°C with 1.11 MBq [5′-32P] cytidine-3′,5-bisphosphate (222 TBq mmol−1, Hartmann Analytic) and 10 units T4 RNA ligase 1 (NEB) in a total reaction volume of 20 µl containing 15% (v/v ...
-
bioRxiv - Biochemistry 2023Quote: ... were ligated to 50 pmol RNA oligonucleotide “20.25” (5’-UCG AAG UAU UCC GCG UAC GU-3’, Dharmacon) with 1 µL T4 RNA ligase 1 (NEB, #M0204S) for 1 h at 16 °C in 15% (v/v ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1.4 units μL−1 T7 RNA polymerase (RNAP, NEB 2 units μL−1 RNase inhibitor (NEB), 50 nM Cas9 (NEB) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1.4 units μL−1 T7 RNA polymerase (RNAP, NEB 2 units μL−1 RNase inhibitor (NEB), 50 nM Cas9 (NEB) ...
-
bioRxiv - Genomics 2021Quote: ... 1 μl of RNAse inhibitor and 3 μl of Antarctic phosphatase (New England BioLabs Inc.). We then performed a kinase treatment adding 4 μl of T4 Polynucleotide Kinase (PNK ...
-
bioRxiv - Genomics 2021Quote: ... The 3′ adapter (sequence: AGATCG-GAAGAGCACACGTCTGAACTC) was ligated using T4 RNA Ligase 1 (NEB, M0204L) and purified nascent RNA using streptavidin beads (NEB ...
-
bioRxiv - Genomics 2019Quote: ... and then cloned into a customized minigene plasmid (a derivative of the pSpliceExpress vector)29 containing an RSV-promoter and two control exons (rat insulin exons 2 and 3) using the NEBuilder® HiFi DNA assembly (NEB, E2621). Amplified fragments were inserted between the two control exons ...
-
bioRxiv - Genomics 2021Quote: The beads were magnetically separated and 4 µl of hot PNK mix (0.2 µl PNK [New England Biolabs], 0.4 µl 32P-γ-ATP, 0.4 µl 10x PNK buffer [New England Biolabs], 3 µl H2O) was added and incubated for 5 min at 37°C in a thermomixer at 1,100 rpm ...
-
bioRxiv - Cell Biology 2024Quote: ... containing a 5′-Biotin-PC group and a 3’-OH (Sup. Table. 2) were ligated to the 5′ end of RNAs using T4 RNA ligase (NEB, Cat #M0204S) for 3 hours at 37°C ...
-
bioRxiv - Biophysics 2021Quote: ... PfK5ΔL6-MD-SNAP was biotinylated or fluorescently labelled by overnight incubation at 4°C with SNAP-Biotin® or SNAP-Surface® Alex Fluor® 647 (New England BioLabs) with at least a 3:1 molar excess of these labels to PfK5ΔL6-MD-SNAP ...
-
bioRxiv - Cancer Biology 2019Quote: ... sequences are listed in Supplementary Table 4) and cloned into pGL3-TK-5UTR-BsmBI-Luciferase using BsmBI (New England BioLabs; Whitby, Ontario, Canada). The “Snail 417” UTR insert was generated by PCR using the forward primer TATCGTCTCAACACCGAGCGACCCTGCATAAGCTTGGCGCTGAGCCGGTGGGCG and the reverse primer ATACGTCTCTCTTCCATAGTGGTCGAGGCACTGGGGTCG ...
-
bioRxiv - Pathology 2021Quote: RT-qPCR was also performed on RNA extracted from the 4 dpi lung samples with NEB Luna Universal One-Step RT-qPCR Kit with SYBR-Green (NEB, Ipswich, MA, USA) to quantify the cytokines IL-6 and IFN-β ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl 10 pM/μl TrAEL-seq adaptor 1 and 1 μl T4 RNA ligase 2 truncated KQ (NEB M0373L). Plugs were then rinsed with 1 ml tris buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Microbiology 2020Quote: ... including equimolar amounts of dGTP and 7-deaza-GTP (New England Biolabs), at a concentration of 200 µM was used (Maertzdorf et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... The solution was diluted by adding 7 ml of ligation buffer (NEB) containing 1% Triton X-100 and 30 Units of T4 DNA ligase (NEB) ...
-
bioRxiv - Biophysics 2022Quote: ... rk430-mScarlet-SNAP (7 μM monomer) was incubated with benzylguanine-biotin (NEB) in a 4 to 1 molar ratio at room temperature for 15 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... 7 μg pNZdmsC3GH plasmid was digested with 40 U of SfiI (NEB), separated on a 1% agarose gel and ...
-
bioRxiv - Microbiology 2022Quote: ... for 7-12 h at 37°C in CutSmart buffer (NEB, B7204S). Digested products were then visualised on a 4% NuSieve (Lonza ...
-
bioRxiv - Molecular Biology 2020Quote: ... was linked to the free hydroxyl group at the 3’-end of transcripts (1 □g of total RNA) by T4 RNA ligase 1 (NEB M0204) in the presence of 15% (w/v ...
-
bioRxiv - Microbiology 2020Quote: ... 3 mM MgCl2 (NEB), 0.24 mg.ml−1 BSA (Fermentas) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 3 (NEB #E7710) were used to create unique identifiers for each cDNA library sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 µL MNase (NEB) was added to a clarified K562 lysate from ∼5 M cells and digested for 30 minutes at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3’ NotI (NEB) before being tested by sequencing (Macrogen ...
-
bioRxiv - Pathology 2019Quote: ... 1 μL (2 units) DNAse I (M0303S, New England BioLabs, Ipswich, MA), and 89 μL nuclease-free H2O ...
-
bioRxiv - Developmental Biology 2020Quote: ... digested vectors by a 1:2 mixture of T4 ligase (NEB, M0202L) and T4 polynucleotide kinase (NEB ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1 µL of 10mM dNTPmix and 2 µL of Phusion polymerase (NEB). PCR products were purified using the QIAquick PCR purification column and eluted with 30 µL Qiagen Elution Buffer ...
-
bioRxiv - Bioengineering 2022Quote: ... 1X of a restriction enzyme mix [1/2 EcoRI-HF® (NEB #R3101 ...
-
bioRxiv - Biophysics 2022Quote: ... 2 μL of a 0.4 µg µL-1 stock of Trypsin (NEB) were added to the samples (to a final enzyme:substrate ratio of 1:50 w/w ...
-
bioRxiv - Genetics 2022Quote: ... were ligated using a 1:2 mixture of T4 ligase (NEB, M0202L) and T4 polynucleotide kinase (NEB ...
-
bioRxiv - Genomics 2023Quote: ... dsDNA was digested by MmeI solution (1× NEB Cutsmart, 2 U MmeI) at 37 °C for 0.5 h and extracted with 12% native polyacrylamide TBE gel (∼84 bp band) ...
-
bioRxiv - Genetics 2023Quote: ... 2 μL 1 M CaCl2 and 5 μL micrococcal nuclease (NEB, #M0247S) were added and chromatin was fragmented into predominantly mono-nucleosomes by incubation at 37°C for 15 min ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µl of 100µM DTT and 1 µl of NudC (M0607S, NEB), then incubated for 30 min at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 1 µl murine RNase inhibitor per sample and 3 µl were added to each sample together with 2 µl truncated T4 polynucleotide kinase (#M0201, NEB; Frankfurt/Main, Germany). Samples were incubated for 2 h at 37°C and the enzyme was deactivated after the reaction by 10 min incubation at 75°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-hydroxyl (5’HO-RNA30-FAM-3’) or 5’-Gppp (5’Gppp-RNA30-FAM-3’) in 1x NEBuffer 3 (NEB; B7003), in 20% denaturing polyacrylamide gels ...