Labshake search
Citations for New England Biolabs :
651 - 700 of 5981 citations for 6H Dibenzo b d pyran 3 pentanaminium 6a 7 10 10a tetrahydro 1 hydroxy N N N 6 6 9 hexamethyl 6aR trans 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Microbiology 2020Quote: ... including equimolar amounts of dGTP and 7-deaza-GTP (New England Biolabs), at a concentration of 200 µM was used (Maertzdorf et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... The solution was diluted by adding 7 ml of ligation buffer (NEB) containing 1% Triton X-100 and 30 Units of T4 DNA ligase (NEB) ...
-
bioRxiv - Biophysics 2022Quote: ... rk430-mScarlet-SNAP (7 μM monomer) was incubated with benzylguanine-biotin (NEB) in a 4 to 1 molar ratio at room temperature for 15 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... 7 μg pNZdmsC3GH plasmid was digested with 40 U of SfiI (NEB), separated on a 1% agarose gel and ...
-
bioRxiv - Microbiology 2022Quote: ... for 7-12 h at 37°C in CutSmart buffer (NEB, B7204S). Digested products were then visualised on a 4% NuSieve (Lonza ...
-
bioRxiv - Molecular Biology 2020Quote: ... was linked to the free hydroxyl group at the 3’-end of transcripts (1 □g of total RNA) by T4 RNA ligase 1 (NEB M0204) in the presence of 15% (w/v ...
-
bioRxiv - Microbiology 2020Quote: ... Total RNA was collected at 9 h post-IFN treatment using Monarch Total RNA Miniprep Kits (NEB). RNA was prepped for RNA sequencing submission using the NEBNext Poly(A ...
-
bioRxiv - Cell Biology 2023Quote: ... (9)C=cell barcode) was used for single-stranded synthesis and Second Strand Synthesis Module (NEB, #E6111) was used for double-stranded cDNA synthesis ...
-
bioRxiv - Biophysics 2021Quote: ... in 500 μl T4 ligase buffer (50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP and 10 mM DTT, pH 7.5, NEB). Before adding the ligase ...
-
bioRxiv - Genomics 2023Quote: ... were mixed in 5 μL of 1x T4 DNA Ligase buffer (50 mM Tris-HCl pH 7.5, 10 mM MgCl2, 1 mM ATP, 10 mM Dithiothreitol; New England Biolabs) at a final concentration of 80 μM each and annealed by heating at 65 °C for 15 min ...
-
bioRxiv - Plant Biology 2021Quote: ... 1 μL 10 mM ATP (New England BioLabs; Ipswitch, MA, USA), 10 units T4 RNA Ligase 1 (New England BioLabs ...
-
bioRxiv - Bioengineering 2022Quote: ... or Nt.BbvCI (NEB; catalog # R0632L (1 µL of 10 units/µL), 10 U of Exonuclease III (1 µL of a 1:10 dilution in 1X rCutSmart Buffer of 100 U/µL stock) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3.5 µL ddH2O and 1 µL 10 µM RTP primer (NEB) was added ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μl of dNTPs (10 mM of each – New England Biolabs), 1 μl of iTP_Linker_r oligonucleotide (2 μM) ...
-
bioRxiv - Genomics 2023Quote: ... 0.64 μL 10 U μL-1 T5 exonuclease (New England Biolabs), 20 of 2 U µL-1 Phusion High-Fidelity DNA Polymerase (New England Biolabs) ...
-
bioRxiv - Microbiology 2020Quote: ... 3 mM MgCl2 (NEB), 0.24 mg.ml−1 BSA (Fermentas) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 3 (NEB #E7710) were used to create unique identifiers for each cDNA library sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 µL MNase (NEB) was added to a clarified K562 lysate from ∼5 M cells and digested for 30 minutes at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3’ NotI (NEB) before being tested by sequencing (Macrogen ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μL of 10 mM ATP and 1 μL of T4 DNA ligase (New England Biolabs) were added and the ligation reaction was incubated for 5 cycles at 20°C for one hour followed by 37°C for 30 min ...
-
bioRxiv - Genetics 2019Quote: ... The gRNA target sequences GAAGAGGTGAACTGCCTTT (NIPBL exon 3) and CTCGTTCTGATTTTAACCG (NIPBL exon 10) were cloned into the gRNA empty vector using Phusion polymerase (M0530S: New England Biolabs, Ipswich, MA) and the Gibson assembly system (E5510S ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-hydroxyl (5’HO-RNA30-FAM-3’) or 5’-Gppp (5’Gppp-RNA30-FAM-3’) in 1x NEBuffer 3 (NEB; B7003), in 20% denaturing polyacrylamide gels ...
-
bioRxiv - Cancer Biology 2021Quote: ... or a polyclonal rabbit antibody against cleaved casp-3 (1:100; New England Biolabs, Frankfurt, Germany), followed by a biotinylated goat anti-rabbit secondary antibody (Abcam ...
-
bioRxiv - Microbiology 2019Quote: ... 600 ng of total RNA were mixed with 0.83 μL 100 mM tris pH 7.5 and 0.17 μL 3 mg·mL−1 Random Primers (NEB) to a volume of 5.25 μL ...
-
bioRxiv - Cancer Biology 2020Quote: ... Positive control slides were treated with 3 U/mL DNase-1 (New England Biolabs, Cat. M0303) for 10 minutes at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... Pre-adenylated L3-1R-App 3’ adaptors were ligated using T4 RNA ligase 1 (M0204, NEB) for 75 min at 25°C ...
-
bioRxiv - Microbiology 2021Quote: ... 50 pmol Oligo d(T)23 (NEB) and 10 pmol Deoxynucleotide Triphosphate Mix (Promega) ...
-
bioRxiv - Cell Biology 2020Quote: ... Magnetic oligo-d(T) beads (NEB, S1419S) were equilibrated in NLB and added to the enrichments ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl 10 pM/μl TrAEL-seq adaptor 1 and 1 μl T4 RNA ligase 2 truncated KQ (NEB M0373L). Plugs were then rinsed with 1 ml tris buffer ...
-
bioRxiv - Genomics 2019Quote: ... the fragmented genomic DNA was ligated with 1 µL of 10 µM phosphorylated hairpin oligo mix (1 µL of NEB T4 ligase, 1 µL of 10x NEB T4 Ligase buffer ...
-
bioRxiv - Microbiology 2020Quote: ... using separate template dilutions (1:1 & 1:10) and high-fidelity Phusion polymerase (New England BioLabs Inc., Ipswich, MA, USA). A single round of PCR was performed using “fusion primers” (Illumina adaptors + indices + specific regions ...
-
bioRxiv - Biochemistry 2022Quote: Native 3’ end extension assays experiments where set-up as describe in the D-loop assays with the exception that dNTP’s (1 mM) and Klenow (exo-)(NEB) were added after 10 minutes of D-loop formation ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µL of RNase H (5,000 U/mL) (New England Biolabs, Fig. 2f and Extended Data Fig. 2c,d) were treated with 1.5 of 10× RNase H buffer in the sample by adjusting with Milli-Q H2O to total 15 µL ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid expressing EBFP2-14-3-3 theta was created using HiFi Cloning (NEB) of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665) ...
-
bioRxiv - Immunology 2021Quote: ... 3’ loxP site and 3’ arm of homology) was linearized with NotI (NEB) and recombineered into RP24-227B3 BAC clone that was transformed into SW102 strain by electrophoration (186 ohms ...
-
bioRxiv - Molecular Biology 2022Quote: ... MCC libraries were generated by digesting the chromatin in low Ca2+ MNase buffer (10 mM Tris-HCl pH7.5, 10 mM CaCl2) for 1 h at 37°C with MNase (NEB, M0247) added in varied concentrations (17-19 Kunitz U) ...
-
bioRxiv - Genomics 2020Quote: ... The treated RNA samples were incubated with 100 μM RNA rP5_RND oligo (final 10 μM, Table S3) 2h at 25°C with 10 Units of T4 RNA ligase 1 (NEB). Please note that we used an RNA oligo ...
-
bioRxiv - Cell Biology 2020Quote: ... or using 400 U of T4 DNA ligase and 1X reaction buffer (50 mM Tris-HCl, 10 mM MgCl2 1 mM ATP, 10 mM DTT, New England Biolabs) at 16°C overnight ...
-
bioRxiv - Microbiology 2023Quote: ... standard curve cDNAs were then serially diluted ten-fold from 10-1 to 10-8 and run through the SYBR Green assay (New England Biolabs) together with sample cDNAs ...
-
bioRxiv - Physiology 2022Quote: ... Diluted lysate was then incubated with 9 ml of packed amylose resin (catalog no. E8021S, New England Biolabs) and incubated at 4°C for 2h with gentle rotation ...
-
bioRxiv - Molecular Biology 2023Quote: Pre-crRNA arrays (Supplementary Table 9) were synthesized using the HiScribe T7 High Yield RNA Synthesis Kit (NEB). T7 transcription was performed for 16 h and then RNA was purified using the Monarch RNA Cleanup Kit (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... nuclei from 2 million MCF-7/NA12878 cells at a viability of ∼95% were resuspended in 200 μl of reaction buffer (1× NEB CutSmart buffer, 0.3 M sucrose). Nuclei were then treated with EcoGII by adding 200 U of EcoGII (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... The samples were transferred to 7 ml of 1.15x T4 ligation buffer (NEB), incubated with 1% Triton X-100 for 1 hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μl of 10-mM deoxynucleoside triphosphate mix (NEB, Ipswich, Massachusetts, USA), 1 μl of each 25-μM primer ...
-
bioRxiv - Plant Biology 2021Quote: ... 10 units T4 RNA Ligase 1 (New England BioLabs; Ipswitch, MA, USA), 1 μL T4 RNA Ligase Buffer (New England BioLabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 μL of 10 mM dNTP mix (NEB N0447S, Ipswich, MA). This initial premix was heated at 65°C for 5 minutes ...
-
bioRxiv - Genomics 2023Quote: ... 1 μl 10 mM mix of dGTP and dTTP (NEB #N0442S, #N0443S), 5 μl 10x T4 DNA Ligase Buffer ...
-
bioRxiv - Biophysics 2023Quote: ... and dGTP were incubated and 10 units of DNA polymerase 1 (NEB) for 6 minutes at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... were added with 1.5 µL of 10× GlycoBuffer 1 (New England Biolabs) in the sample by adjusting with Milli-Q H2O to total 15 µL ...