Labshake search
Citations for New England Biolabs :
651 - 660 of 660 citations for 6 CHLORO 4' METHYLFLAVONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... GM16 genomic DNA using primers SA-Reg FWD and SA-Reg REV (Table 4) and polymerase Q5 (New England Biolabs, Massachusetts, USA). The destination plasmid pGW44 [33] was linearized using primers pGW44 FWD and pGW44 REV ...
-
bioRxiv - Biophysics 2021Quote: ... PfK5ΔL6-MD-SNAP was biotinylated or fluorescently labelled by overnight incubation at 4°C with SNAP-Biotin® or SNAP-Surface® Alex Fluor® 647 (New England BioLabs) with at least a 3:1 molar excess of these labels to PfK5ΔL6-MD-SNAP ...
-
Comprehensive profiling of antibody responses to the human anellome using programmable phage displaybioRxiv - Immunology 2022Quote: 5 μl ligation reactions were set up with a total of 500 ng DNA (vector and insert at a 1:4 molar ratio) and high-concentration T4 DNA ligase (NEB Cat No. M0202T). The ligation mix was packaged using the T7Select Packaging Extract (EMD Millipore ...
-
bioRxiv - Cancer Biology 2019Quote: ... sequences are listed in Supplementary Table 4) and cloned into pGL3-TK-5UTR-BsmBI-Luciferase using BsmBI (New England BioLabs; Whitby, Ontario, Canada). The “Snail 417” UTR insert was generated by PCR using the forward primer TATCGTCTCAACACCGAGCGACCCTGCATAAGCTTGGCGCTGAGCCGGTGGGCG and the reverse primer ATACGTCTCTCTTCCATAGTGGTCGAGGCACTGGGGTCG ...
-
bioRxiv - Pathology 2021Quote: RT-qPCR was also performed on RNA extracted from the 4 dpi lung samples with NEB Luna Universal One-Step RT-qPCR Kit with SYBR-Green (NEB, Ipswich, MA, USA) to quantify the cytokines IL-6 and IFN-β ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL ligation mix (2 µL 10x T4 ligase buffer, NEB, 1 µL T4 RNA ligase 2, truncated, NEB, 1 µL Ribolock inhibitor) was added and incubated (1 h ...
-
bioRxiv - Genetics 2021Quote: ... 5 μg of MBP-Rif2 or MBP-Rif2-min (see recombinant protein preparation) was incubated for 1 h at 4 °C with amylose resin (New England Biolabs, 50 μl per reaction). The resin with the immobilized MBP-Rif2 variants was washed 5 times with 1 ml wash buffer (50 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Plant Biology 2024Quote: ... when OD600 reached 0.5 for 4 h at 37 °C and then they were purified using amylose resin column (New England Biolabs, for MBP related proteins purification) or Ni-NTA agarose column (Qiagen ...
-
bioRxiv - Cell Biology 2019Quote: ... a linker flanked by AgeI and SacII restriction sites was introduced into pcDNA™4/TO between EcoRI and XhoI restriction sites using Gibson Assembly® (New England Biolabs, Ipswich, MA, USA). The SYFP2 fluorophore was inserted downstream of the linker between SacII and XbaI restriction sites using pSYFP2-C1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... GGGMcm3 (in association with the other Mcm2-7 subunits) was cleaved off the resin with 500 units of 7×His-TEV protease (NEB; rotation overnight at 4°C). The flow-through was collected and applied to 0.4 mL volume Ni-NTA Agarose resin (Qiagen ...