Labshake search
Citations for New England Biolabs :
651 - 700 of 3630 citations for 6 4 METHYLPIPERAZIN 1 YL NICOTINONITRILE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
bioRxiv - Systems Biology 2021Quote: ... for each oligo pool we used 50 femtomoles of template and 4 cycles of PCR in each of multiple 50 microliter reactions (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Microbiology 2021Quote: ... All generated plasmids of this study (Table 4) were cloned with restriction endonucleases and T4 ligase from NEB (New England Biolabs) or Gibson assembly (NEBuilder® HiFi DNA Assembly ...
-
bioRxiv - Cancer Biology 2020Quote: ... we performed eight 100 μl PCR reactions per sample (4 μg DNA per reaction, 32 μg per mouse) using Q5 High-Fidelity 2x Master Mix (New England Biolabs, M0494X). The PCR products were purified with Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 μl of the diluted samples was then denatured by addition of 4 M urea and Proteinase K (40 U/ml; New England Biolabs #P8107S), incubated for 5 min at 65°C ...
-
bioRxiv - Microbiology 2022Quote: ... containing ampicillin resistance marker were amplified by PCR with corresponding primers (Supplementary Data 4) in Q5® High-Fidelity 2X Master Mix (New England BioLabs). Both the insert (MCR-MOR ...
-
bioRxiv - Molecular Biology 2020Quote: ... then incubated for 2 h at 37°C in 100 μl 1x TdT buffer containing 4 μl 10 mM ATP and 2 μl Terminal Transferase (NEB M0315L). Plugs were rinsed with 1 ml tris buffer (10 mM Tris HCl pH 8.0) ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was generated from RNA using 4 µL of 5X ProtoScript II buffer (cat. n° M0368L, NEB, New England Biolabs, USA), 2 µL of 0.1 M Dithiothreitol (cat ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was generated from RNA using 4 µL of 5X ProtoScript II buffer (cat. n° M0368L, NEB, New England Biolabs, USA), 2 µL of 0.1 M Dithiothreitol (cat ...
-
bioRxiv - Cancer Biology 2020Quote: ... the oligonucleotides containing the different gRNA-pairs (Supplementary Table 4) were amplified with Phusion High-Fidelity polymerase (New England Biolabs, M0530S) using primer F5 and R1 (Supplementary Table 2) ...
-
bioRxiv - Synthetic Biology 2022Quote: All pLS plasmids listed in Supplementary Table 4 were synthesized as gBlocks by IDT and circularized either by ligation with T4 DNA ligase (New England Biolabs, USA), or ...
-
bioRxiv - Synthetic Biology 2019Quote: The adipic acid biosensing plasmid (JBx_101898) was assembled of 4 DNA parts by NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs, MA): First ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μg of the extracted genomic DNA was digested for 4 h at 37☐ using 10 U MmeI (New England Biolabs). The DNA was then immediately dephosphorylated by treatment with 1 U calf intestine alkaline phosphatase (Invitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... mCherry and control (GAPDH) expression levels were measured separately by qPCR from 4 uL of diluted cDNA using Taq DNA Polymerase (NEB, #M0270L), dsGreen DNA detection dye (Lumiprobe ...
-
bioRxiv - Neuroscience 2022Quote: ... Three to four independently generated PCR products for each OT1-4/founder were purified using the Monarch PCR & DNA Cleanup Kit (NEB Inc.) and sent for Sanger sequencing at the OHSU Vollum Sequence Core.
-
bioRxiv - Microbiology 2022Quote: ... Purified protein (4 μg) was deglycosylated with 500 U of Endoglycosidase H (Endo H) (New England Biolabs, Ipswich, MA, United States) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2022Quote: ... with a terminal elongation step for 4 min at 72°C employing a proofreading Taq polymerase (Q5 High-Fidelity DNA polymerase, New England Biolabs, Germany). After verification of the amplicon sequence ...
-
bioRxiv - Genetics 2023Quote: ... 4 µg of DNA in 80 µl reaction were incubated at 37°C for seven minutes and randomly fragmented to 300 bp – 4 kb size products using NEBNext® dsDNA Fragmentase (New England BioLabs) and then cleaned using 0.5x SPRI beads ...
-
bioRxiv - Genetics 2023Quote: ... After 48 h cells were incubated for 30 min at 37 °C with SNAP-Oregon green (NEB, final concentration 4 µM). Cells were then incubated for 30 min at 37 °C in fresh media to wash off unbound substrate ...
-
bioRxiv - Microbiology 2023Quote: ... Digestion products were diluted by the addition of 4 mL 1.1× T4 DNA Ligase Reaction Buffer (New England BioLabs® Inc) with 1% Triton X-100 and incubated for 1 h at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 μg of venom in 10 µL of reducing SDS-PAGE buffer (6X stock solution, NEB B7024S with 30% β-mercaptoethanol) was run per lane on BioRad™ Mini PROTEAN pre-cast TGX acrylamide gels (15 well ...
-
bioRxiv - Microbiology 2024Quote: ... acidocaldarius DSM 639 wild type using the primers (Eurofins Genomics) listed in supplementary Table 4 employing the Q5 polymerase (NEB, USA) following the manufacturers’ instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... The RNase III-treated samples were pre-incubated with 4 U of RNase III (New England Biolabs, Ipswich, Massachusetts, USA, M0245S) in reaction supplemented by 20 mM MnCl2 at 15 °C for one hour ...
-
bioRxiv - Biochemistry 2020Quote: ... Diatom exconjugants were selected on 1/2L1 1% agar medium supplemented with 20 μg mL−1 phleomycin (Gold Biolabs) at a diel cycle of 14:10 at ~50 μE ms−1 light intensity.
-
bioRxiv - Genomics 2022Quote: The crRNAs and tracRNA (see Extended Table 3) were mixed 1:1 to 1 μM in supplied buffer 3.1 (NEB) with 0.2 U/μl RNaseOUT™ (Invitrogen) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µg non-methylated NEAT1_1 IVT product was radio-labelled with radioactive labelling mix (1 µL 10x PNK buffer, NEB, 1 µL NEAT1_1 IVT product, 1 µL T4 PNK, NEB, 1 µL γ-32P-ATP ...
-
bioRxiv - Biochemistry 2021Quote: ... The fragments were ligated into the pLSV101 vector (1:1 and 3:1 molar ratios) with T4 DNA ligase (New England Biolabs) (10 °C for 30 s and 30 °C for 30 s alternating overnight) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl 10 pM/μl TrAEL-seq adaptor 1 and 1 μl T4 RNA ligase 2 truncated KQ (NEB M0373L). Plugs were then rinsed with 1 ml tris buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... 50 μl of lysed cells were aliquoted to 8 tubes containing 450 μl of digestion mix (1× NEB 1 buffer, 1% triton X-100, and 100 U HpaII enzyme [NEB]) and incubated at 37 °C for 3 hours with constant shaking ...
-
bioRxiv - Genomics 2019Quote: ... the fragmented genomic DNA was ligated with 1 µL of 10 µM phosphorylated hairpin oligo mix (1 µL of NEB T4 ligase, 1 µL of 10x NEB T4 Ligase buffer ...
-
bioRxiv - Microbiology 2020Quote: ... using separate template dilutions (1:1 & 1:10) and high-fidelity Phusion polymerase (New England BioLabs Inc., Ipswich, MA, USA). A single round of PCR was performed using “fusion primers” (Illumina adaptors + indices + specific regions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Proximity ligation was performed using 1 unit/ml RNA ligase 1 (NEB), 1x RNA ligase buffer ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The cells were resuspended in 1 mL of 1× NEBuffer 2.1 (NEB) and homogenized by grinding to a fine powder in liquid nitrogen ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 mM phenylmethylsulfonyl fluoride (PMSF) and 1 x Protease Inhibitor Cocktail (NEB) as described before (Sun et al. ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 1 μg of amilCP_Orange chromoprotein was digested with 1 μL PflMI (NEB) with r3.1 buffer (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 μl of 20,000 U.ml−1 exonuclease I (New England Biolabs M0293) and 5 μl of 10X exonuclease I buffer (New England Biolabs B0293S ...
-
bioRxiv - Biochemistry 2021Quote: ... 100 μM ATP including 1 unit/μL T4 RNA ligase 1 (NEB) (final volume 300 μL ...
-
bioRxiv - Microbiology 2023Quote: ... In vitro Xrn-1 digests were performed with 1U Xrn-1 (NEB), 10U RppH (NEB) ...
-
bioRxiv - Genomics 2022Quote: ... 1× CutSmart Buffer (NEB) and 15 units of Quick CIP (NEB ...
-
bioRxiv - Genomics 2022Quote: ... 1× CutSmart Buffer (NEB) in nuclease-free water to form RNPs ...
-
bioRxiv - Genomics 2020Quote: ... and NEBuffer 1 (NEB) to the library and incubated at 37 °C for 1 hour ...
-
bioRxiv - Biophysics 2019Quote: ... Apyrase (1 unit, NEB) was added and incubated overnight at 4° C ...
-
bioRxiv - Genetics 2021Quote: ... rSAP (1 Unit, NEB) and RNasin (20 units ...
-
bioRxiv - Genetics 2020Quote: ... 1:50 (NEB, 14001), (5 ...
-
bioRxiv - Genetics 2020Quote: ... 1:100 (NEB, 51255), (4 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and ligase 1 (NEB) sequentially ...
-
bioRxiv - Microbiology 2021Quote: ... 1 mM ATP (NEB), 1×T4 DNA Ligase Buffer and 800 U T4 DNA ligase (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... 1× Buffer 2.1 (NEB), 2 µg BSA and 3 units of T4 DNA polymerase (NEB ...
-
bioRxiv - Biochemistry 2021Quote: ... coli Topoisomerase 1 (NEB), 0.1 mg/ml BSA ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 µl MlyI (NEB). The digest was incubated at 37°C for 1 hour ...