Labshake search
Citations for New England Biolabs :
651 - 700 of 1902 citations for 5 nitrobenzothiazole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... Purified RNA was treated with RNA 5′ pyrophosphohydrolase (New England Biolabs) for 2 h at 37℃ ...
-
bioRxiv - Genomics 2023Quote: ... RNA was digested with addition of 5 U RNaseH (NEB, M0297) to the first strand cDNA synthesis reaction and incubation at 37 °C for 20 min.
-
bioRxiv - Genomics 2023Quote: ... RNA was digested with addition of 5 U RNaseH (NEB, M0297) to the first strand cDNA synthesis reaction and incubation at 37°C for 20 min ...
-
An mRNA processing pathway suppresses metastasis by governing translational control from the nucleusbioRxiv - Cancer Biology 2021Quote: ... Unligated linkers were removed from the reaction by yeast 5’-deadenylase (NEB) and RecJ nuclease (NEB ...
-
bioRxiv - Genomics 2020Quote: ... DNA ends were dephosphorylated by addition of 5 μL rSAP (NEB, M0203) and incubation at 37°C for 45 min ...
-
bioRxiv - Microbiology 2020Quote: ... These DNA fragments were subsequently 5’ phosphorylated using T4 PNK enzyme (NEB), then cloned into a SmaI-cut pUC19 using T4 DNA ligase (NEB) ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNAs were monophosphorylated on their 5’ ends using T4 polynucleotide kinase (NEB) and either 3 mM unlabeled ATP (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... Obtained RNAs were 5’-radiolabelled with T4 polynucleotide kinase (New England Biolabs) and [γ32P] adenosine triphosphate (ATP ...
-
bioRxiv - Molecular Biology 2020Quote: This oligonucleotide was adenylated using the 5’ DNA adenylation kit (NEB, E2610S) as follows ...
-
bioRxiv - Molecular Biology 2020Quote: ... The linkers were pre-adenylated with a 5’ DNA Adenylation kit (NEB), and then used for the ligation reaction ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 mM EDTA and 40 U/ml RNAse inhibitor (New England Biolabs) at 4 °C for 5 min to remove non-specifically associated proteins ...
-
bioRxiv - Genomics 2020Quote: ... and SalI (5’-GTCGAC-3’, New England Biolabs Inc., MA, CA#R3138S) restriction enzymes ...
-
bioRxiv - Molecular Biology 2021Quote: ... triplex reaction was treated with either 5 units of RNase H (NEB) or 10εg of RNase A (Life Technologies ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 µl of a broad range protein marker (New England Biolabs, #P7708) was run alongside the samples on each gel to estimate the molecular weight ...
-
bioRxiv - Microbiology 2019Quote: ... and the 5’ overhang was filled in with T4 DNA polymerase (NEB). Following purification ...
-
bioRxiv - Molecular Biology 2019Quote: ... The linkers were pre-adenylated with a 5’ DNA Adenylation kit (NEB), and then used for the ligation reaction ...
-
bioRxiv - Genetics 2019Quote: ... and 5 μl of 3,000 U/ml T4 DNA polymerase (NEB, M0203L) were added to the tube containing the DNA sample ...
-
bioRxiv - Genetics 2019Quote: ... and 1µl of 5 U/μl large DNA Polymerase I (NEB, M0210L) were added ...
-
bioRxiv - Microbiology 2019Quote: ... T5 exonuclease diluted 1:5 with 5X reaction buffer (New England BioLabs) (0.01 units/µL) ...
-
bioRxiv - Microbiology 2019Quote: ... 5 μL of this reaction mixture were transformed into XL10Gold cells (NEB).
-
bioRxiv - Molecular Biology 2020Quote: ... phosphorylated by T4 polynucleotide kinase at the 5’ ends (NEB, Ipswich, MA) at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... and the 5′-hydroxyl group was repaired with T4 polynucleotide kinase (BioLabs). The libraries were generated using TruSeq small-RNA adaptors and sequenced using NextSeq500 (Illumina).
-
bioRxiv - Genomics 2021Quote: ... augments Cap-specific 5’ adapter ligation by T4 RNA ligase 1(NEB). The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... A mix of 5 µL of 10X NEB2.1 buffer (New England Biolabs), 1.25 µL of 1 mM dATP ...
-
bioRxiv - Cell Biology 2021Quote: ... instead of dCTP and 5 U/μl Klenow fragment Dpol I (NEB) at 37°C for 2 h ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and A-tailed using Klenow (3′-5′ exo-; New England Biolabs M0212L). Illumina-compatible adapters were subsequently ligated to DNA ends ...
-
bioRxiv - Genetics 2020Quote: ... and 5 μl of 400 U/μl T4 ligase (NEB M0202S/L), and incubated for 4 hours at room temperature with rotation ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was degraded using 5 units RNase H (New England Biolabs M0297) for 30 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 μl of 10 U/μl T4 polynucleotide kinase (NEB; Cat#: M0201L), 1 μl of 5 U/μl Klenow DNA polymerase ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 3.6 μl of 5 U/μl Klenow (exo-) (NEB; Cat#: M0212S). The reactions were carried out for 45 min at 37 °C in a PCR machine ...
-
Barcoding and demultiplexing Oxford Nanopore native RNA sequencing reads with deep residual learningbioRxiv - Genomics 2019Quote: ... Each IVT product was 5’ capped using Vaccinia Capping Enzyme (NEB-M2080S) following the manufacturer’s recommendations ...
-
bioRxiv - Systems Biology 2021Quote: ... Beads were resuspended at 5 µg µl-1 followed by MseI (NEB) digestion according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Dephosphorylated RNA was then 5’ end-labeled with 20U T4 PNK (NEB) and 30μCi [g32-P]ATP (Perkin-Elmer) ...
-
bioRxiv - Genomics 2021Quote: ... and A-tailed using Klenow Fragment (3’→5’ exo-) (New England Biolabs) followed by the ligation of NEXTFLEX® Bisulfite-Seq adapters ...
-
bioRxiv - Molecular Biology 2020Quote: ... A mix of 5 μl 3’Ligation Reaction Buffer 2x (NEB-kit) and 1.5 μl of 3’Ligation Enzyme Mix (NEB-kit ...
-
bioRxiv - Microbiology 2021Quote: ... and subsequently 5’-dephosphorylated with Calf intestinal alkaline phosphatase (New England Biolabs). CviAII cuts on a sequence motif ‘CATG’ which is highly frequent on bacterial genomes ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µl of sample was used in PCR with OneTaq polymerase (NEB) with primers Cas168 GGGACAGATACGCGTTTGAT and Cas169 GCCTAACTGAACGGTTTGA as described previously (31) ...
-
bioRxiv - Cell Biology 2021Quote: ... and tumbled with 5 μg of anti-m6A antibody (New England Biolabs) at 4°C overnight ...
-
bioRxiv - Biophysics 2020Quote: We used in vitro mutagenesis (Q-5 Site-directed Mutagenesis Kit, NEB) to introduce the mutations creating d isoforms using the following primers ...
-
bioRxiv - Biophysics 2020Quote: ... By replacing dCTP with 5-methyl-dCTP (New England BioLabs, Ipswich, MA) in the nucleotide mix ...
-
bioRxiv - Genomics 2022Quote: ... 5 mM EDTA) supplemented with Proteinase K (New England Biolabs Cat. # P8107S) was added to the beads for both ChIP and input chromatin ...
-
bioRxiv - Molecular Biology 2022Quote: 5’-end 32P-labelled DNA substrates were generated using T4 PNK (NEB) and [ɣ-32P]ATP (PerkinElmer) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’ and 5’ adaptors were ligated by truncated ligase 2 (NEB) and ligase 1 (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... augments Cap-specific 5’ adapter ligation by T4 RNA ligase 1 (NEB)(Hetzel et al. ...
-
bioRxiv - Genetics 2022Quote: ... Eluted cDNA was amplified 5-cycles (NEBNextµltra II Q5 master mix (NEB) with Illumina TruSeq PCR primers RP-1 and RPI-X ...
-
bioRxiv - Molecular Biology 2022Quote: ... Butyryl-Histone H4 (Lys 5) rabbit pAb (PTM Biolabs, SKU: PTM 313), Butyryl-Histone H3 (Lys 27 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and A-tailed using Klenow Fragment (3’→5’ exo-) (New England Biolabs) followed by the ligation of NEXTFLEX® Bisulfite-Seq Adapters ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 U/mL RNase Inhibitor (M0314S; New England Biolabs, Ipswich, MA, USA), EDTA-free protease inhibitor cocktail ...
-
bioRxiv - Microbiology 2020Quote: ... which were then degraded by the 5′-3′ ssDNA exonuclease RecJ (NEB). After rRNA depletion using the Ribo-Zero Gold rRNA removal kit (Illumina) ...
-
bioRxiv - Microbiology 2021Quote: ... Ligations were used to transform NEB 5-alpha competent cells (NEB C2987H) and the cloned spacer was verified by Sanger sequencing using primer PSP108 ...