Labshake search
Citations for New England Biolabs :
651 - 700 of 5241 citations for 5 OXO 5 6 7 8 TETRAHYDRO NAPHTHALENE 1 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... NEB 5-alpha competent E.coli (NEB #C2987H, Ipswich, MA, USA) were transformed with ligated plasmid by heat shock at 42°C for 30 seconds ...
-
bioRxiv - Cell Biology 2023Quote: ... using Large Klenow fragment 3’-5’ exo- (New England Biolabs). Biotinylated 19x 601 array DNA ...
-
bioRxiv - Genomics 2023Quote: ... by using Klenow Fragment (3′→5′ exo-) (New England Biolabs) for 30 min at 37 °C and purified by using a QIAquick PCR Purification Kit ...
-
bioRxiv - Cancer Biology 2023Quote: ... Linker reactions were removed with 5′ deadenylase (New England Biolabs) and Rec J Exonuclease (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... The library was transformed into 5-alpha electrocompetent cells (NEB), grown in liquid culture ...
-
bioRxiv - Genomics 2023Quote: ... The libraries were transformed into 5-alpha electrocompetent cells (NEB). The plasmid library was prepared by maxi-prep (Sigma) ...
-
Cas13d-mediated isoform-specific RNA knockdown with a unified computational and experimental toolboxbioRxiv - Genomics 2023Quote: ... we performed 2 reactions per sample (20 µl 5× NEB Q5 buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... and 5 µl of prestained protein ladder (New England Biolabs). The gel was electrophoresed at 150 V ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μL of T4 PNK buffer (NEB, cat. no. M0201S) and 5 μL of 10 mM ATP (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5′-hydroxyl group repair (T4 polynucleotide kinase (M0201L; NEB) were conducted on beads ...
-
bioRxiv - Developmental Biology 2023Quote: ... Protruding 5’ ends were filled in with Klenow enzyme (NEB) in the presence of [P]-32 dCTP (Hartmann Analytics ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 5’-phosphate was added via T4 polynucleotide kinase (NEB) at 37 ºC for 30 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... ∼500 bp 5’ and 3’ flanking regions of Tb427.10.12290 (NEB) with primers SMD400/1 and SMD404/5 respectively using (Lister strain 427 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µg of replicon plasmid was linearised with AscI (NEB), purified by phenol-chloroform extraction ...
-
bioRxiv - Genomics 2024Quote: ... The 5′ adapter was ligated with T4 RNA ligase (NEB), followed by a third biotinylated RNA enrichment ...
-
bioRxiv - Bioengineering 2024Quote: ... grown in 5-alpha competent Escherichia coli (NEB, Ipswich, MA) and purified using the PureYield MidiPrep System (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... 7 μl PEG8000 and 1 μl T4 RNA ligase 2 K227Q (NEB) at 25 °C for 1 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... The fragment release step was performed in 5 μl 1% SDS supplemented with 1:10 Thermolabile Proteinase K (New England Biolabs cat. no. P8111S) at 37°C 1 hr followed by 58°C 1 hr ...
-
bioRxiv - Cancer Biology 2023Quote: ... The fragment release step was performed in 5 μl 1% SDS supplemented with 1:10 Thermolabile Proteinase K (New England Biolabs cat. no. P8111S) at 37°C 1 hr followed by 58°C 1 hr ...
-
bioRxiv - Cell Biology 2023Quote: ... 250 μL of 2 mg mL-1 Y289L GalT,46 50 μL of 500 kU mL-1 PNGase F (New England Biolabs, 5 U μg-1 of protein), and 62.5 μL of Lambda Protein Phosphatase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 µl 10 x dNTPs with dUTP instead of dTTP (2 mM each) and 1 µl T4 polymerase (NEB) were added and the mixture was incubated at 37°C in a thermal cycler for 20 min ...
-
bioRxiv - Biochemistry 2021Quote: ... 2.5 μl of reaction was added to a tube containing 5 μl replication buffer and 1 μl MseI (NEB) for 3 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... Ncas_Int679_For 5′ GGCAAATTTGTATGAGGGATAAA and Ncas_Int679_Rev 5′ TAATTCGATTACGTTAGCTGTT) and cloned into pRS403-pGAL1-hpSC_URA3 (1) using PsiI and NaeI restriction enzymes (New England Biolabs, NEB). In addition ...
-
bioRxiv - Cell Biology 2021Quote: ... COS-7 cell lysates from FLAG-ACBD4(wACBD5_FFAT)/5 (mFFAT) expressing cells were treated for 1 h with λPP (New England BioLabs) as described above ...
-
bioRxiv - Biochemistry 2020Quote: Every single stranded oligonucleotide (1 nmol) was 5’-end-phosphorylated with 40U of T4 Polynucleotide kinase (New England Biolabs) by incubation at 37°C in 1x T4 DNA Ligase Reaction Buffer.
-
bioRxiv - Microbiology 2020Quote: ... 0.5 μM of each forward and reverse primer (Supplementary Table 1) and 2.5 U Long Amp Taq Polymerase (NEB) in a total volume of 25 μL ...
-
bioRxiv - Genomics 2020Quote: ... Capture plate wells contained 5 µl of capture solution (1:500 Phusion High-Fidelity Reaction Buffer, New England Biolabs; 1:250 RnaseOUT Ribonuclease Inhibitor ...
-
bioRxiv - Genetics 2022Quote: ... 1 µL of extracted genomic DNAs and 5 µL of 2× Hot Start High Fidelity Q5 Master Mix (NEB). PCR reactions were carried out under the following condition ...
-
bioRxiv - Cell Biology 2022Quote: ... the fragment and vector were mixed in a 5:1 ratio and ligated with T4 DNA Ligase (NEB, M0202L) overnight at 16°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... To obtain dephosphorylated TOP2B used for in vitro kinase assay and mass spectrometry the YFP column incubated twice for 15 min at room temperature in wash buffer supplemented with 0.1mM MnCl2 and 5 units mL-1 calf intestinal phosphatase (NEB), 400 units mL-1 lambda protein phosphatase (NEB) ...
-
bioRxiv - Immunology 2023Quote: ... were single-cell sorted into 5 µl 1% (v/v) Nonidet P40 Substitute, Tris-HCl (20 mM, pH 8.0) containing 5 U murine RNase inhibitor (NEB) using a FACSAriaIII instrument (BD) ...
-
bioRxiv - Developmental Biology 2023Quote: ... After centrifugation the EtOH-precipitated fragments were resuspended in water and ligated to 0.25 µM randomized 5’ RNA adapter using T4 RNA ligase 1 (NEB) in the same buffer conditions as described above ...
-
bioRxiv - Neuroscience 2023Quote: ... Ligation of 5’ adaptor to already 3’ ligated RNA product was performed with T4 RNA ligase 1 (NEB, #EL0021) at 37°C for 1 h ...
-
bioRxiv - Molecular Biology 2023Quote: NCBP1-NCBP2 at 1.2 μM was incubated with mALYREF2 (residues 1-155) at 3.6 μM in the presence of the 5’ cap analog m7GpppG (NEB) at 500 μM at 4 °C for 0.5 hr ...
-
bioRxiv - Molecular Biology 2023Quote: ... A 5′ adapter (rArCrArCrUrCrUrUrUrCrCrCrUrArCrArCrGrArCrGrCrUrCrUrUrCrCrGrArUrCrU, IDT) was then ligated to RNAs to the product using T4 RNA ligase 1 (NEB) for 4 hours at 15°C ...
-
Atypical epigenetic and small RNA control of transposons in clonally reproducing Spirodela polyrhizabioRxiv - Plant Biology 2024Quote: ... The elution was then ligated to 5′ barcoded RNA adapters using T4 RNA ligase 1 (New England Biolabs, #M0204). To reduce ligation biases ...
-
bioRxiv - Plant Biology 2021Quote: ... 1 μL Bacillus stearothermophilus (Bst) DNA polymerase (8 U μl-1) (New England Biolabs), 2 μL DNA template ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 5× Q5 buffer and pUC19 plasmid as template (New England Biolabs) in 50 μl ...
-
bioRxiv - Cell Biology 2020Quote: ... and further digested overnight with 5 U DpnII (New England Biolabs) at 37°C in a humidified atmosphere ...
-
bioRxiv - Molecular Biology 2021Quote: ... followed by phosphorylation of the 5’ end with T4 kinase (NEB). Phosphorylated RNA was then purified by the RNeasy kit (Qiagen ...
-
bioRxiv - Molecular Biology 2021Quote: ... after which 5’end was repaired with T4 polynucleotide kinase (NEB). Nascent RNAs containing the adaptors were converted to cDNA ...
-
bioRxiv - Genomics 2020Quote: ... with 2 μl (5 U/μl) of Klenow fragment exo- (NEB) in a final volume of 55 μl by incubation at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... The labeled oligonucleotide (∼5 pmol) was treated with uracil glycosylase (NEB) in 1x UDG buffer (20 mM Tris-HCl ...
-
Direct analysis of ribosome targeting illuminates thousand-fold regulation of translation initiationbioRxiv - Molecular Biology 2020Quote: ... RNAs were 5′ capped using the Vaccinia Capping System (NEB M2080S) and 3′ biotinylated using the Pierce RNA 3′end biotinylation kit (Thermo Scientific 20160).
-
bioRxiv - Molecular Biology 2020Quote: ... 5’-triphosporylated RNA was capped with 3’-desthiobiotin-TEG-GTP (NEB)) using the Vaccinia virus Capping enzyme (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: The size selected nascent RNA was treated with 5’ Pyrophosphohydrolase (NEB) in ThermoPol® reaction buffer following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ ends were phosphorylated by 20 U polynucleotide kinase (PNK; NEB) by adding 1 mM ATP (Thermo Scientific) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 U Taq DNA polymerase (New England Biolabs, NEB, Inc, USA) and 13 μM of each of the primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 U Taq DNA polymerase (New England Biolabs, NEB, Inc, USA) and 13 μM of each of the primers ...
-
bioRxiv - Molecular Biology 2021Quote: ... All guides were 5′-phosphorylated using T4 PNK (New England Biolabs) except experiments with 5′-OH guides ...