Labshake search
Citations for New England Biolabs :
651 - 700 of 4087 citations for 5 Bromo 2 Tert Butyldimethylsilyl 4 Methylthiazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Second DNA adapters (containing 5 [N5] or 10 [N10] random bases at the 5′-end) were ligated to the 5′-end of the cDNA (T4 RNA Ligase, NEB). The DNA was amplified by PCR and purified with PippinPrep system (Sage Science ...
-
bioRxiv - Molecular Biology 2023Quote: The nascent RNAs bound to Streptavidin Dynabeads were 5’ de-capped by diluting in RNA 5’ Pyrophosphohydrolase (RppH) mix (NEB) and incubation at 37 °C for 45 minutes ...
-
bioRxiv - Biochemistry 2022Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using 5′ DNA adenylation kit at the 5′ end (NEB). To reduce a ligation bias ...
-
bioRxiv - Cell Biology 2022Quote: ... It was followed by a second In-Fusion HD cloning of a polymerase chain reaction using 5’-GAAGGGGATCCACCGATGGTGAGCAAGGGCGAGG-3’ / 5’-TTAGTAGCTCTAGACTTGTACAGCTCGTCCATGCC-3’ (mScarlet insert) using BamHI and XbaI (New England Biolabs).
-
bioRxiv - Genomics 2022Quote: Add 5 μl of dNTP mix (10 mM each) and 5 μl of DNA polymerase I Klenow fragment (NEB, M0210) to the reaction system ...
-
bioRxiv - Bioengineering 2023Quote: The barcoded FXN region was recovered from the resulting cDNA library or DNA using primers of 5’-TGGACCTAAGCGTTATGACTGGAC-3’ and 5’-GGAGCAACATAGTTAAGAATACCAGTCAATC-3’ and PCR was performed using Q5 2x Master Mix (New England BioLabs) at 25 cycles of 98°C for 10s ...
-
bioRxiv - Cancer Biology 2023Quote: ... Half-hairpin sequences were amplified from the genomic DNA (common forward primers 5′- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTCTTGTGGAAAGGACGA-3′ and reverse primer 5′-CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCTACTATTCTTTCCCCTGCACTGT-3′) using Q5 High-Fidelity 2x Master Mix (NEB). PCR reactions were cleaned up using Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2023Quote: ... Non-IRES mRNAs were capped the 3’-O-Me-m7G(5’)ppp(5’)G anti-reverse cap analog (NEB # S1411L). IRES mRNAs were capped with the A(5’)ppp(5’)G cap analog (NEB # S1406L) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and adenylated using a 5′ DNA adenylation kit at the 5′ end (NEB). To reduce ligation bias ...
-
bioRxiv - Cell Biology 2024Quote: ... The mutagenesis primers for the addition of the STOP codon at the end of the MPV17 gene from MPV17-HA plasmid (F: 5’-TAATCTAGAATGTACCCATACGATGTTC-3’; R: 5’-GAGCCGATGTGCCTTCCA-3’) were generated using the NEBaseChanger bioinformatic tool (NEB). The mutation was confirmed and the plasmids were validated using Sanger sequencing (Eurofins Discovery).
-
bioRxiv - Microbiology 2024Quote: ... The resulting cDNA was then amplified by PCR using the PBAD 5’- RACE universal primer (5’ACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCAT3’) and the S17-specific primer IgBP3151-171R (5’CTTGCGATCTCGGGCTAAATCCACCA3’) in the presence of Q5 DNA polymerase (NEB) and dNTPs ...
-
bioRxiv - Immunology 2024Quote: ... A custom ribonucleoside blend was used comprising 3′-O-Me-m7G(5′)ppp(5′)G cap analog (New England Biolabs), ATP ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 3′ adapter was conjugated with an amino CA linker instead of dCC at the 3′ end (GeneDesign) and then adenylated at the 5′ end with a 5′ DNA adenylation kit (NEB). Four random nucleotides were added in the 3′ and 5′ adapters [(5′ -rAppNNNNTGGAATTCTCGGGTGCCAAGG/amino CA linker-3′ ...
-
bioRxiv - Neuroscience 2024Quote: ... The UNC13A CE was amplified with a forward primer in exon 19 5’-CAGACGATCATTGAGGTGCG-3’and reverse primer in exon 22 5’-ATACTTGGAGGAGAGGCAGG-3’using Q5 High Fidelity Master Mix (NEB). PCR products were resolved on a TapeStation 4200 (Agilent ...
-
bioRxiv - Cell Biology 2024Quote: ... FP: 5’-AGCAAGGCTAGCCAAGACAAGTTTGTAC-3’ and RP: 5’-ACTCACGGGCCCTAGTGGGCAGATCTT-3’ and cloned between Nhe-1 and Apa1 (NEB, Ipswich, MA, USA) sites in TTpl503 [mec4p::Lamp-1::GFP]
-
bioRxiv - Developmental Biology 2024Quote: ... pax9el622 fish were genotyped using primers F3 (5’-TCGGAACAGGTCAGAATAGGA-3’) and R3 (5’-TCGGAACAGGTCAGAATAGGA-3’) and Bsrl digestion (New England Biolabs), producing digested wild-type bands (611 and 186 bp ...
-
bioRxiv - Microbiology 2021Quote: ... The digested DNA (4 ml in total) was split into 4 aliquots and diluted in 8 ml ligation buffer (1X ligation buffer NEB 3 (without ATP), 1 mM ATP ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5 µl NEB CutSmart buffer (NEB, B7204) in a reaction volume of 50 µl for 3 hrs at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... 5 units of LongAmp taq DNA polymerase (NEB) and 50 ng of DNA sample extracted from infected cells in a 50 ⍰l final reaction volume ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 10 U/uL of 5’ deadenylase (NEB M0331S), 10 U/uL Rec J exonuclease (Epicentre RJ411250) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and MseI to generate 5’ TA overhangs (NEB). After dephosphorylation ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5% (v/v) Ribonucleoside Vanadyl Complex (NEB)) at 4°C for 10 min ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5% (v/v) Ribonucleoside Vanadyl Complex (NEB)) and homogenized centrifuged at 15.000 g at 4°C.
-
bioRxiv - Cancer Biology 2020Quote: ... 5 μl 10X CutSmart Buffer (New England Biolabs), 10 μl 10mM ATP (New England Biolabs) ...
-
bioRxiv - Immunology 2021Quote: ... Uracil-DNA glycosylase (NEB, #M0280S, 5 U/ul) was added and the reaction was incubated for 1 h at 37°C ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and 5 units of Klenow DNA polymerase (NEB) to 80 µL of repaired mononucleosomal DNA to a final reaction volume of 120 µL ...
-
bioRxiv - Neuroscience 2020Quote: ... or α2-3,6,8 Neuraminidase (5 U/ml; NEB) for 2 hours before motoneurons were added (Supplementary Figure 7).
-
bioRxiv - Molecular Biology 2020Quote: ... 0.5 μl 5’Ligation Reaction Buffer (NEB-kit) and 1.25 μl of 5’Ligation Enzyme Mix (NEB-kit ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 μM dNTP (New England Biolabs, # N0446S) in 17.5 μl 1x CutSmart buffer (New England Biolabs ...
-
bioRxiv - Biophysics 2021Quote: ... and 5 mg/mL purified BSA (NEB, G9001S), to prevent non-specific interaction of Cy5-eIF4E with the chip surface ...
-
bioRxiv - Molecular Biology 2022Quote: ... and processed with 5 units of T7EI (NEB) for 1 hour at 37 °C before resolved on 10% TBE PAGE gels (BioRad ...
-
bioRxiv - Cell Biology 2022Quote: ... add 5 μL Proteinase K (New England BioLabs), scrape cells from 24-well ...
-
bioRxiv - Molecular Biology 2022Quote: ... with 5 μl T4 Ligase Buffer (NEB, B0202), 400 units T4 Ligase (NEB ...
-
Spatial rearrangement of the Streptomyces venezuelae linear chromosome during sporogenic developmentbioRxiv - Microbiology 2020Quote: ... 5 µl of NEB3 buffer (New England Biolabs) and 10.75 µl of DNase-free water (Invitrogen ...
-
bioRxiv - Bioengineering 2021Quote: ... 5 µl of 10X NEB2 buffer (NEB, US), and 35 µl of nuclease-free water ...
-
bioRxiv - Molecular Biology 2020Quote: ... NEB 5-alpha F’Iq cells (New England Biolabs) were used as the recipient strain for all plasmid constructions ...
-
bioRxiv - Biophysics 2021Quote: ... 5 μL of CKII kinase (New England Biolabs) and 2.5 μL λ phosphatase (New England Biolabs ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL Klenow fragment (3’→5’ exo-) (NEB), and 9 μL of DEPC H2O to each reaction and incubating at 37 °C for 30 min ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA was treated with RNA 5’ Pyrophosphohydrolase (NEB) according to the manufacturer’s instructions prior to RNA circularization ...
-
bioRxiv - Immunology 2021Quote: ... and RNAs were 5’dephosporylation by quickCIP (NEB). Input (sRNA ...
-
bioRxiv - Genomics 2021Quote: ... using Large Klenow fragment 3’-5’ exo- (NEB).
-
bioRxiv - Synthetic Biology 2023Quote: ... Escherichia coli NEB 5-a (New England Biolabs) was used for cloning ...
-
bioRxiv - Molecular Biology 2023Quote: ... Escherichia coli NEB- 5-alpha (New England Biolabs) was used for cloning and BL21(DE3 ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μL 20 μM Cas9 (New England BioLabs), and 5 μL of 40 μM transcribed dgRNAs ...
-
bioRxiv - Genomics 2023Quote: ... 5 µl of T4 DNA ligase (NEB, #M0202L), and 4 µl of 200 ng/µl linker were added to the 260 μ l of digested chromatin and mixed thoroughly ...
-
bioRxiv - Cell Biology 2023Quote: ... Coverslips were incubated with: 5 units RNaseH1 (NEB) in RNaseH1 Buffer (50 mM Tris-HCl pH 8.3 ...
-
bioRxiv - Microbiology 2022Quote: ... and 5’ end repair with T4 PNK (NEB). The 5’-RNA adapter (5’-CCUUGGCACCCGAGAAUUCCA-3’ ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 U µL-1 T7 RNA polymerase (NEB) and 0.2 µg µL-1 template DNA ...
-
bioRxiv - Genomics 2024Quote: ... followed by 5′ cap repair with RppH (NEB) and 5′ hydroxyl repair with PNK (NEB) ...
-
Autorepression of Yeast Hsp70 co-chaperones by intramolecular interactions involving their J-domainsbioRxiv - Biochemistry 2024Quote: ... SIS1VR 5’- CCAATCTGTTCGCGGTGAGCCTCA-3’) by Gibson Assembly (NEB). All constructs were confirmed by sequencing.